Morgan and Tyler - 1099 Words

The evolutionistic theory refers to the biological concept of progress and development. The theory states that organisms were meant to increase in complexity, and later on included cultural and social evolution by comparing primitive tribal groups to modern society, and studying how certain aspects in the tribal groups were repeated all over the continent. Edward B. Tylor and Lewis H. Morgan brought the term evolution to anthropology, which makes them crucial to the growth and improvement of anthropology. Morgan focused on building upon his theory of social evolution in which he made links between social and technological progress. He studied and emphasized the kinship relationships across various cultures and larger social†¦show more content†¦Edward Burnett Tylor was an Englishman who focused mainly on the development of religion but also studied human cultural development and Montesquieu’s three stages of savagery, barbarism and civilization. He also looked at moral qualities by focusing and comparing primitive people to civilization. Even though Tylor did not do any ethnographical field work or trust information from colonies or missionaries, he went on holidays to warm climates due to his sickness, where he then learnt and participated in different cultures and societies. He believed that people should appreciate new places and the view of different cultures. Tylor expanded on Montesquieu’s ideas and said the savagery time was the time when there was no technology or in other words, technology was considered as rocks or stone tools, and then he referred to barbarism as the time of agriculture and food production and finally, civilization which to him meant the invention of writing. Taylor also believed that civilization was a time of happiness and where moral qualities were built. Even though Tylor focused on aspects Morgan didn t in Montesquieu’s theory, he was mostly interested by religion and the evolution of it. He studied the origin of the religion and thought the belief in spirits and god had to be a universal response to universal experiences such as death, dreams and reflected images and said these concepts would form a dualityShow MoreRelatedA Report On The s Bedroom891 Words   |  4 Pages17-year-old son Tyler Scott who stated he was awakened at about 3:30 a.m. by a loud banging sound coming from his father’s and Ms. Everette’s bedroom. Tyler’s bedroom is across the hall from Officer Scott’s and Ms. Everette’s bedroom. Tyler stated he got out of bed to see what was happening in the house. Tyler stated he heard his father yell, â€Å"Get off me!† Tyler stated his father came out of the master bedroom while Ms. Everette was yelling at him. Officer Scott stood next to Tyler in the hallwayRead MoreR ivermore portfolio Essay1008 Words   |  5 PagesSolver) or use a commercial package. Concepts: performance evaluation with historical data, forecasting asset returns, portfolio choice with input uncertainty. Computer skills: development and/or use of a mean-variance optimizer Case Roberta Tyler consultants to several university investment offices around the country. She specializes in asset allocation studies. She has accumulated performance figures from a number of different university endowments, as well as information about the typicalRead MoreWorkplace Literacy and Effective Communication1270 Words   |  6 Pagesshould take care not to muddle the message. Dawn Josephson, president of Cameo Publications, states If you send out a sales letter that is filled with errors, youre losing credibility. You send the image that your company is careless (cited in Tyler, 2003, 87). Therefore, an indicator potentially leading to a loss of business and previously cited low morale. Establishing and maintaining credibility is not the only reason for effective communication and in our attempt to clarify this need;Read MoreEssay about Workplace Literacy and Effective Communication1253 Words   |  6 Pagesshould take care not to muddle the message. Dawn Josephson, president of Cameo Publications, states â€Å"If you send out a sales letter that is filled with errors, you’re losing credibility. You send the image that your company is careless† (cited in Tyler, 2003, 87). Therefore, an indicator potentially leading to a loss of business and previously cited low morale. Establishing and maintaining credibility is not the only reason for effective communication and in our attempt to clarify this need; theRead MoreCharles Darwins Evolutionary Theory1223 Words   |  5 Pagesthird stage- everyone else is a savage or barbarian. In addition to Spencer, we have also learned about Tyler and Morgan in class, in which they tried to make deductions about the variations in societal structures through one single deductive theory. Almost like how Auguste Comte thought there could be a single equation in explaining and predicting into how societies work, Tyler and Morgan thought there was a one single deductive theory to explain societies. Sir Walter Balwin Spencer went toRead MoreOmnivores Dilemma1260 Words   |  5 Pagesagricultural system. Foods would be sourced locally, from family farms such as Joel Salatins minor ecological rotation farm (Pollan 2009). Relationship Marketing is recommended, wherein a relationship would develop between consumers and local farmers (Morgan 1994). Such a localized food distribution system would reduce artificial costs as well as allow consumer to have full knowledge about what they are eating and what processes the food has gone through. This assumes that a small, local farmer will beRead MoreAreas that Could Be Improved and Avoided in Future Studies and Reports on Colorectal Health560 Words   |  3 PagesIn 2010 a study was published by Phyllis D. Morgan, Joshua Fogel, Indira D. Tyler, and John R. Jones titled Culturally Targeted Educational Intervention to Increase Colorectal Health Awareness among African Americans. This study will be examined following an objective critique of the research conducted and reported. This analysis will show areas that could be improved and avoided in future studies and reports. This study was conducted to increase colonoscopy screening for colorectal cancer (CRC)Read MorePrejudice in To Kill a Mockingbird by Harper Lee and in Maya Angelou Literature1145 Words   |  5 Pagesby Charles Drew (1945), the cellular phone by Henry T. Sampson (1971), the toilet by T. Elkins (1897), the dryer by G.T. Sampson (1862), the elevator by Alexander Miles (1867), the fire extinguisher by T. Marshall (1872), the gas mask by Garrett Morgan (1914), the typewriter by Burridge and Marshman (1885), and the list goes on. Prejudice confuses the past. â€Å"But the color of a negro’s skin makes him easily recognizable, makes him suspect, converts him into a defenseless target†(Black Boy 213)Read MoreGender Is A Black And White Topic1195 Words   |  5 Pagessurgery to create the appearance of the external genitals typical of the other anatomic sex† (Rathus et al., 2014, pg.161). In a study conducted by Morgan Stevens (2008), it was found that a sense of body-mind dissonance is the first recognition of a transgendered identity, which usually occurs early in childhood. One of the participants of this study, Tyler- a female transitioning to a male, explains his story. â€Å"At the time, I really didn’t know what was wrong with me. I just knew that I was born wrongRead MoreToronto Maple Leafs Contenders1337 Words   |  5 Pagescore; an ideal example of these drafts is Morgan Rielly. Drafted 5th overall in 2012, Morgan Rielly will give the Leafs everything they need to make the playoffs this season. O n January 1st, 2014, the Leafs acquired Tim Gleason, part of a trade that sent John- Michael Liles packing his bags and heading off to the Carolina Hurricanes. As a manager Nonis was clear to point out the Leafs possessed no shortage of â€Å"puck moving† defenseman in Jake Gardiner, Morgan Rielly, and Cody Franson. What they needed

Freedom Riders Speech - 788 Words

Before segregation ended, many people believed that it was best for everything and everyone if people were treated differently based on their race or ethnicity, but also many believed that segregation should end. Many of the people who thought it should end protested for equal rights. Because of the time period , it was a really big deal if you protested to end something that most people wanted and thought was the best idea anyone has ever had. Often people felt so intimidated by the people who wanted to end segregation that it eventually led to violence. In 1960, a group of brave people of a variety races came up with the idea of â€Å"Freedom Rides†. They knew the consequences of their cause, a 13 person group, protesting†¦show more content†¦Ã¢â‚¬Å"Student activists, white and black, were trained to expect Violence even though it frequently went against their instincts to protect themselves† (created equal). The way the nonviolent strategy worked and how they used the strategy is by not giving in to the other protestors. It wasn’t easy for the Freedom Riders to be hit , spit on and things like that and being told that you can’t do anything about it and you can’t defend yourself. The people The Freedom Riders not to fight back, didn’t believe in nonviolence either. The reason they had to do it was because even if the black people didn’t have every white person in the world , on their side, but the percentage that was on their side, would be gone in an instance if they fought Back. â€Å" The 1961 Freedom Rides sought to test a 1960 decision by the Supreme Court in Boynton v. Virginia that segregation of interstate transportation facilities, including bus terminals, was unconstitutional as well.† (history) The Freedom riders protested at different protests around the country , them doing that selflessly made a huge impact on a lot of people and places. Each time the freedom riders protested , they achieved more and more. â€Å"The first Freedom Ride took place on May 4, 1961 when seven blacks and six whites left Washington, D.C., on two public buses bound for the Deep South.† (core). The Freedom riders impacted many people’s beliefs and if they were afraid To stand upShow MoreRelatedDuring the Civil Rights Movement era there were many prominent figures and parties that challenged1100 Words   |  5 Pagesmany prominent figures and parties that challenged the nation to change societys views on racism. No other group challenged the accepted standards as much as the Freedom Riders. The Freedom Riders impact on political and social views influenced a drastic shift in the behaviors and thought of the Southern states. Many aspects of the Freedom Rides were influenced by the Journey of Reconciliation. The Journey of Reconciliation was comprised of a wide array of Caucasian and African American men of allRead MoreEssay on Freedom Riders1426 Words   |  6 PagesThe Freedom Riders were a group of college students and leaders of various racial equality organizations, both blacks and whites, which tested the law of integration for public transportation. The law was instated, but Alabama especially didn’t follow it. The Freedom Riders rode buses into the cities to see if the townspeople accepted or declined the new law. They in turn ended up beating, pummeling, and chasing the riders out of town with the white mobs. The Freedom Riders violently fought the segregationRead MoreEssay about Martin Luther King Jr and His Life907 Words   |  4 Pagesthink it refers to what happened on August 28th 1963, a hot summer day when a quarter of a million people showed up on the steps of the Lincoln memoria l. That day was the March on Washington for Jobs and Freedom, brought together by civil rights groups and religious groups at the time, king gave a speech to try and open the countries eyes about it. Just a year earlier, only 6.7% of African Americans were able to vote in the state of Mississippi. The goal of this event was to shed light on the politicalRead MorePersuasive Speech Outline Essay1117 Words   |  5 PagesPersuasive Speech Outline ALL 50 STATES SHOULD HAVE MANDATORY MOTORCYCLE HELMET LAWS TOPIC: Mandatory motorcycle helmet laws PURPOSE: To persuade the audience that all 50 states should enact and enforce a mandatory motorcycle helmet law. THESIS STATEMENT: Mandatory helmet laws save lives and dollars. INTRODUCTION ï‚ · ï‚ · ï‚ · Did you know that only 19 states and the District of Columbia have laws in place that require all motorcycle riders to wear a helmet? 19!? 28 states have laws coveringRead MoreAnalysis Of March By John Lewis861 Words   |  4 Pagesothers endure. Although he experienced many events in his life, John Lewis used those events to build himself religiously and help others. Receiving his first bible, Jim Lawson’s workshops, his decision not to go to college and Martin Luther King’s speech all helped him become who he is. One of Lewis’ earliest turning points in his life was when his uncle gave him his first bible. Lewis recalls, â€Å"Growing up, what I really wanted to be was a preacher. An uncle gave me a bible for Christmas when I wasRead MoreA Trip Through the Civil Rights Movement1057 Words   |  4 Pagespush forward. Secondly, here comes the Freedom Riders. The Freedom riders traveled down the south to protest the Jim Crow laws, and to request change. But this journey didnt sail smoothly. The Freedom riders faced hatred and violence along their way. White people would throw objects at the windows of the bus they were traveling on, and even went to extreme measures of setting the bus on fire. Even this nonviolent demonstration landed the freedom riders in jail. Fighting for equality wouldnt beRead MoreCivil Rights Movement of the 50s and 60s1425 Words   |  6 Pagesevent of the civil rights movement involved the Freedom Riders. This was a group of people that came from the north and entered the south to show support for desegregation. The Freedom Riders would board busses and attempt to reach New Orleans. The Freedom Riders were met with heavy opposition and time and time again they were beaten and arrested. The culminating event was when Martin Luther King Jr. flew to Montgomery to suppor t the Freedom Riders. King held a meeting at a church and the churchRead MoreEssay on The Civil Rights Movement1014 Words   |  5 Pagesand pursued by fellow activist leader E.D Nixon and soon led by King. During this time King’s house was bombed and he was later arrested. The Freedom Rides were journeys taken by Civil Rights activists on interstate buses into the segregated southern states of America. These were organized by the Congress of Racial Equality (CORE), the first Freedom Ride left Washington D.C. on May 4, 1961. Activists travelled to the highly segregated South and sought to integrate seating and desegregate bus terminalsRead MoreBy the late 1950s, the African American community was ready to fight for the major social change600 Words   |  3 Pagesact of protest. Some early forms of the sit-in movement were the Freedom Rides, which were developed to test a 1946 Supreme Court decision declaring that segregation on interstate transportation was unconstitutional.1 In 1947, the civil rights group known as the Congress of Racial Equality organized a Journey of Reconciliation, sending eight black men and eight white men on buses across the South. Beginning on April 9, 1947, the riders, which included Eugene Stanley from North Carolina AT UniversityRead MoreAfter slavery was abolished, African Americans never had the same rights as other U.S. citizens. In800 Words   |  4 Pagesgroup of Freedom Riders traveled on bus right after the Supreme Court outlawed segregation on public transportation. These Freedom Riders were attacked and beaten shortly after their first journey however. During this period, Dr. Martin Luther King Jr. was a strong advocate and preacher for civil rights. Dr. King was arrested multiple times for protesting without a permit in many states and one of the most remembered was in 1963 in Birmingham, Alabama. Mid 1963, President Kennedy gave his speech promising

Peer group influence free essay sample

Introduction: High school Students cluster inside the campus, regard as peer group. Belonging to a group derives satisfaction where it creates a feeling of general well-being in individual. Peer group has in one way or the other influenced the life of students both academically socially, morally, psychologically and otherwise. The peer group maybe a dominant factor to consider in academic achievement of students in school. Acceptance by the group depends on the conformity. The influence of peers can be both positive and negative. On the positive side, it can serve as an important incentive for adolescents to perform well in school. On the negative side, peer influence can lead to discipline problems and delinquent behaviors both inside and outside school. Thus, the values of peers can play an important role in students’ educational experiences and outcomes. Most education takes place on group situation. The group impact and influence on its members is so strong that it takes the group as a whole to support the learning process. On way of looking at influence is to consider students who are involved in school activities such as sports, drama, student council and other activities tend to do better in school; however it is important factor on the students who believe that education is valuable, that they tend to do better in school. This paper deals with the study on peer groups, on how to be aware not only of their role but also of the changes that might come up to the student, because of their influence. What kinds of friends do high school students have? Are their friends interested in learning and studying and in participating in social activities? Do they belong to a group that likes to indulge in risk-taking activities? Do their patterns of peer association change over the course of their enrollment in high school? These questions can be addressed by a series of questions appearing in the first and second follow-up surveys of NELS:88, in which students were asked to report on the importance they felt their friends placed on various activities or goals. Their responses are presented in figure 1. Figure 1. Percentage of students reporting that their friends consider it very imiportant to do the following things: 1990 and 1992 SOURCE: U. S. Department of Education, , National Education Longitudinal Study of 1988, First and Second Follow-Up Surveys. As the survey results show, most high school students had friends who cared about school learning and achievement. For example, in 1990, a majority of high school sophomores (81 percent) reported that their friends considered finishing high school very important. While about one-third of them (36 percent) thought that their friends valued studying, half or more reported that their friends placed high priority on attending class (58 percent), getting good grades (51 percent), and continuing education after high school (53 percent). Although this general pattern remained fairly stable after two years when most of these students were seniors, there were some differences. As seniors, these students perceived their friends as placing somewhat less emphasis on class attendance and good grades, but more on higher education than they did two years previously when they were sophomores. 4 While the majority of high school students reported having friends who cared about learning, some of them also said they had friends who were highly interested in social activities. In 1990, more than one-third (36 percent) of high school sophomores said that their friends considered it very important to be popular with their peers. About one fourth of the sophomores also described their friends as being very interested in playing sports (29 percent) and having a steady boyfriend or girlfriend (22 percent). These proportions, however, declined after two years, when the majority of the sophomores were seniors. In the senior year, for example, one-fifth of these students (21 percent) described their friends as being interested in playing sports, one-fourth of them (28 percent) thought that their friends were very interested in being popular with their peers, and less than one-sixth of them (16 percent) said their friends considered having a boyfriend or girlfriend very important. In 1992, a small proportion of sample members reported that they had friends who considered having sex, using drugs, and drinking very important. As shown in figure 1, one in every five sample members (21 percent) thought that having sex was very important to his or her friends. About 10 percent thought that their friends considered drinking very important and 3 percent responded that using drugs was very important to their friends. The influence of these friends on an adolescents school learning would be an important topic for researchers to pursue in the future. Peer Groups According to Students Demographic and Academic Characteristics Do male and female students differ in their choice of friends in high school? Do students from different social and racial-ethnic backgrounds have different kinds of friends? Do academically oriented students associate with like-minded peers? The following analyses address these questions. To simplify the analyses, factor analysis was first conducted on the items shown in figure 1 separately for both the 1990 and 1992 data (see the technical appendix of this report for the actual factor loading). A series of bivariate analyses were then performed to compare students from different demographic and academic backgrounds in terms of their peer association. Peer groups. Three factors emerged from this factor analysis, each corresponding to a distinctive value students perceived their friends to have (table 1). The first factor, seen in both the 1990 and 1992 data, consisted of the items relating to the degree of importance students friends placed on school learning. The second factor, also seen in both surveys, consisted of items that described the degree of importance students friends placed on social activities. The third factor, based only on 1992 data, included items that measured the extent to which students friends placed importance on engaging in delinquent behaviors. Each factor described the kinds of friends students had in high schooli. e. , learning-oriented peers, socially active peers, and those oriented toward delinquent activities. All three factors were continuous standardized variables, with a mean of 0 and standard deviation of 1 on the sample used in the study. When a student had a higher score on a particular factor (e. g. , factor I), this indicates that his or her friends valued more these things summarized by this factor (e. g. , school learning). Students could also have friends that valued more than one factor (e. g. , socializing and academics. Table 1. Peer groups identified by NELS follow-up data in 1990 and 1992 Factor Students friends emphasizing I School learing and achievement (in 1990 and 1992 data) Attending class regularly Studying Getting good grades Finishing high school Continuing education after high school II Social activities (in 1990 and 1992 data) Playing sports Being popular with students Having a steady boy/girlfriend III Engaging in delinquent activities (only in 1992 data) Having sexual relations Using drugs Drinking SOURCE: U. S. Department of Education, , National Education Longitudinal Study of 1988, First and Second Follow-Up Surveys. Male versus female students. Male and female students differed with respect to the value orientations of their friends. As shown in table 2, in 1990, male students were more likely than their female counterparts to have friends who took school learning seriously (i. e. , the factor mean for females is 0. 16, larger than that of-0. 12 for males). Males, on the other hand, were more likely than females to associate with peers who placed emphasis on social activities. Two years later (1992), these gender differences changed little. Male and female students also differed in the extent to which they associated with another type of friendi. e. , one who valued engaging in delinquent behaviors. Based on the 1992 data, male students were more likely than female students to report that they had friends who considered it important to engage in delinquent behaviors. 5 Table 2. Importance that students friends place on school learning, social activities, and engaging in delinquent behaviors, by student demographic and academic characteristics: 1990 and 1992 SOURCE: U. S. Department of Education, , National Education Longitudinal Study of 1988, First and Second Follow-Up Surveys. Minority versus white students. In both 1990 and 1992, Asian/Pacific Islander students were more likely than white students to report having learning-oriented friends. On the other hand, Asian/Pacific Islander students were less likely than their white peers to have friends who were interested in sex, drugs, and drinking. This finding is consistent with a recent study conducted by researchers from Stanford University and the University of Wisconsin that found that Asian-American students tend to form academically focused groups that study together, encourage each other, and strive for high grades (Leslie 1996). Contrary to past research that has hypothesized a disidentification with academic achievement among black students (Steele 1992), 10th-grade black students in 1990 were more likely than white students to describe their friends as being academically minded (i. e. , the factor mean for black students is 0. 24, compared to -0. 02 for whites). This difference, however, was not apparent after two years (1992). 6 Black students in 1992 were less likely than their white counterparts to describe their friends as being interested in engaging in delinquent behaviors. 7 Previous studies indicated that black students tend to disdain academic accomplishment, sometimes dismissing it as acting white (Ogbu 1985). Whether this explains the change observed here needs further investigation, however. In both the 1990 and 1992 surveys, no differences were found between Hispanic or American Indian/Alaskan Native students and their white counterparts in the extent to which they associated with learning-oriented friends. While Hispanic 10th-graders were less likely than white students to have friends who emphasized social activities, no other differences were found between minorities and whites in the association with such friends. Students from different socioeconomic backgrounds. Students from high-SES families were more likely than low-SES students to have friends who emphasized school learning and achievement. This pattern appeared to be quite stable throughout the high school years and is consistent with previous findings by Coleman ( 1961 ) and Hollingshead (1949). Interestingly, students with different SES backgrounds did not differ significantly in terms of their association with peers who emphasized social activities or engaging in delinquent behaviors. Students from different academic backgrounds. There is reason to believe that students who care about learning are more likely to associate with peers who share this interest than those who have less interest in learning. This belief is supported by the data shown in the lower panel of table 2, where three measures of academic background were examined: (1) educational expectations in the 10th grade; (2) average GPA in reading, mathematics, science, and social studies from the 9th to 10th grades; and (3) whether a student had ever repeated a grade since the first grade. As expected, students who had higher educational expectations, obtained a higher GPA, and had never repeated a grade were more likely to have learning-oriented friends throughout high school years than those who had lower expectations, had a lower GPA, or had been retained in a grade. Differences were especially large between students who expected to pursue college or graduate education and those who expected only high school graduation and between students who had an A average and those who had a D average. Academically strong students were less likely than their academically weak counterparts to have friends who valued delinquent behaviors. However, few differences existed in terms of students association with peers who were interested in social activities. This suggests that while students with different academic backgrounds distinctively chose friends who cared about (or did not care about) learning, or who thought engaging (or not engaging) in delinquent behaviors important, they equally liked (or did not like) to have friends who were fond of social activities. How Does Students Peer Association Relate to Their Educational Outcomes? What are the educational outcomes for students who associate with learning-oriented friends, socially active peers, or peers who think having sex, using drugs, and drinking are very important? Table 3 presents an answer to this question. Six educational outcomes were examined in this investigation: (1) reading proficiency level in the 12th grade; (2) math proficiency level in the 12th grade; (3) dropping out of school at least once between 9th and 12th grade; (4) enrollment in an academic program in high school; (5) high school graduation status in 1994; and (6) postsecondary education attendance in 1994. Since students gender, race-ethnicity, and SES were related to the kinds of friends they chose (see table 2), and it is also well known that these demographic characteristics are correlated with the set of educational outcomes examined here, these relationships were investigated after adjusting for these student characteristics. 8 For reading and mathematics proficiency level in 12th grade, a composite score of 10th-grade achievement in reading, mathematics, science, and social studies was also included for additional adjustment. 9 As shown in table 3, while students association with socially active peers seemed to be unrelated to their educational outcomes, their association with learning-oriented or delinquent-type peers did relate to their success in school. For example, compared with students with friends who showed a relatively low level of interest in learning, those with friends who cared most about school learning were less likely to drop out of school, and more likely to be enrolled in an academic program, to reach an advanced level of reading and math proficiency during their last year of high school, to graduate from high school, and to continue their education after high school. Students with friends who placed importance on pursuing sex, drugs, and drinking differed markedly in terms of their educational performance. For instance, students association with more such friends was related to a higher rate of dropping out of school, a lower rate of being enrolled in an academic program in high school, graduating from high school, and continuing their education after high school. It should be noted that all of these relationships were estimated after controlling for students SES, race-ethnicity, and gender, and that for reading and mathematics proficiency, the estimation also controlled for 10th-grade achievement. Summary and Implication for Future Research The results presented in this report suggested that high school students differed significantly in their choice of friends. Some students had friends who were concerned with school learning and achievement. Some had friends who valued dating, playing sports, or being popular with their peers. A smaller proportion liked to associate with those who were interested in having sex, using drugs, and drinking. The results presented in this report further demonstrated that the kinds of friends students had in high school were related to a wide range of important educational outcomes, after holding constant important demographic characteristics and previous academic achievement. Although it remains unclear at this point whether peer association had a causal and independent influence on students learning, the results of this study clearly suggested that students who had more learning-oriented friends tended to perform better in school than other students over the course of their schooling, and students who spent time with those interested in delinquent activities were less likely to experience success in school. Based upon these results, future research may pursue: (1) identifying factors related to students choice of friends; (2) incorporating school characteristics to explore whether students attending different types of schools associate with different kinds of peers; and (3) investigating the effect of peer associations on students learning and other important educational indicators, such as course-taking behavior or dropping out of school. References Coleman, J. S. (1961). The Adolescent Society. New York: The Free Press. Epstein, J. L. and Karweit, N. (1983). Friends in Schools:Patterns of Selection and Influence in Secondary Schools. New York, Academic Press. Hollingshead, A. B. (1949). Elmtowns Youth. New York: Wiley. Ingels, S. J. , Scott, L. A. , Lindmark, J. T. , Frankel, M. R. , and Myers, S. L. (1992). NELS:88 First Follow-Up: Student Component Data File Users Manual. NCES 92-030. Washington, DC: U. S. Department of Education, Office of Educational Research and Improvement. Leslie, C. (1996). Will Johnny Get As? Newsweek 72 (July 8). Ogbu, J. U. (1985). The Consequences of the American Caste System. In The School Achievement of Minority Children. New Perspectives, ed. V. Neisser. Hillsdale, NJ: Erlbaum, 19-56. Steele, C. M. (April 1992). Race and Schooling of Black Americans. Atlantic Monthly, 68-78 A sorority is an association composed of women who have common interests or who share a common trait. One of the most famous types is the North American college sorority, although similar college groups can be found in other regions of the world as well. Women can also form social associations outside of the college framework. The primary goal of such groups is to create a bond among the women through their common membership. Though these associations are typically composed only of women, some do allow men to join. In college sororities, prospective members usually attend events during a period early in the semester that is designated as â€Å"rush week. † During rush week, people can visit different groups to get a feel for each ones members and style. If a student wants to join, she submits an application, and the existing members vote on the applications at the end of rush week, using their interactions with prospective members as a guideline. Many also have academic requirements, such as a minimum grade point average. Once accepted into the group, new members undergo initiation to become full members. Initiations at sororities and fraternities are infamous, and some colleges have enacted rules designed to protect student safety in initiations. Dangerous hazing activities are often explicitly banned, and pledges are informed that they have the right to refuse to participate in initiation activities that conflict with their safety or religious beliefs. Despite this, initiation can be dangerous or traumatizing for some initiates. Many college fraternities are established with academic criteria for membership. People who wish to join typically participate in activities that take place over the course of a week at the start of a semester. Since most colleges with a system have multiple fraternities, these events usually take place during the same week for all groups, allowing people to explore all their options. This period is known as â€Å"rush week. † After rush week, current members of the fraternity decide which new members should be voted in. Traditionally, new pledges participate in an initiation ceremony that has historically been accompanied by hazing challenges. Due to concerns about the risks of hazing that involve dangerous activities and drinking, many colleges have explicitly banned it in the interest of student safety. Some colleges have also cracked down on fraternity parties in response to complaints from other students and the surrounding community.

The Boys from Brazil Essay Example

The Boys from Brazil Essay The boys from Brazil| Written by Ira levin | A horrible plan is devised by former Nazi doctor Joseph Mengele. Journalist Yakov Lieberman, Jewish journalist, and Nazi hunter, discovers the plans of Mengele. His plan is to kill the fathers of the 94 boys, who are made by Joseph Mengele himself by cloning the DNA of Adolf Hitler. The two hunt each other, which comes to a climax at the home of one of the children, namely family Wheelock. Mengele’s experiment is about making clones of Adolf Hitler himself, and with this terrifying plan, Joseph Mengele would like to take over the world with clones of Hitler.My research question: Is Mengele able to dominate the world by using clones of Hitler? The question now is what does Mengele want to achieve? First, Joseph Mengele is an old Nazi-doctor, who worked in a concentration camp in Auschwitz during the second world war. Mengele wants to take over the world, making a fourth Reich, with the goal to continue the ideas of Hitler. The ideas are that the world has to be inhabited by people who do not have any deviations. This is based on the relieve that Mengele and his comrades see the German people as the purest and most beautiful race on earth, and what needs to be brought back.The way in which Mengele wants to achieve this goal is complicated. He wants to get his hands on the world, by cloning the genetic material of Adolf Hitler in 94 boys . The boys arise and live in a simulated environment, where their parents have the same jobs as Hitler’s parents did have. Mengele thinks this will increase the chance for the arise of the new Hitler. But why this way? First by using of clones, the offspring who has the same genetic characteristics as the cruel dictator.The idea is that when you have the same DNA, you are identical and to your predecessor, with the same characteristics. Second, during the reign of the Nazis, Hitler won the votes of the people by praising them. He impressed the people by telling them they w ere strong and said tha other people made the Germans worse, he created a perfect situation to come to power. Mengele wants to achieve a Fourth Reich in exactly the same way, therefore he needs a descendant of Hitler. The murders all took place under conditions and with a reason.The gruesome plan of Mengele now is to murder the fathers of the boys at the time the boys are 12 years old, because Hitler lost his father at the same age, according to Mengele this moment in Hitler’s life would have been decisive for the development of the beast in him. Lieberman discovers Mengele’s plan , and he immediately takes action. This story takes place in 1976, almost 30 years after the Second World War. After the war, Joseph Mengele fled to Brazil and adopted a different name. Because Mengele is underground, he is free to free put his plan into practice.Namely the people all over the world think that Joseph Mengele no longer exists, that the Nazi regime was ousted, and gone forever, so they thought they did not have to worry about a new rise of the Nazi regime. But will Mengele’s plan succeed? Mengele will not able to take power in this way, and I will explain why not. First, Mengele is chasing Lieberman, because Lieberman has discovered the plan of Mengele to kill a next victim, Mr. Henry Wheelock. Lieberman is doing everything to prevent this murder. But Mengele spied Liebermann and knows to visit Wheelock earlier.When Mengele is trying to persuade and cajole the son of Mr. Wheelock, by saying that he is a descendant of Hitler and he is the greatest, he gets an unexpected answer: â€Å"Who are my parents? He challenged ‘Who am I? ’ â€Å"Your father is Adolf Hitler† â€Å"You know what? † the boy said. â€Å"You are the biggest nut I have ever met! † The son of Wheelocks has been to school and had lessons in History. He knows better than to believe just a strange guy. The son did not think about the possibility of re combination techniques. If even one child says its an idiot plan, it says enough. Everyone is conviced Mengele is crazy.Second, the plan is a big gamble. It is impossible to create a cruel person like Hitler by cloning his DNA and raise the boys in slightly similar conditions. It is impossible to form a new leader. That Hitler developed such radical ideas was a combination of character, living conditions and social events, such as the economy of Germany and the First world war. It is simply impossible to replicate the conditions and therefore it will not be possible to create a new Hitler as Mengele tells himself. Mengele thinks because genetic material is present in the boys, they start acting like Hitler.But what it important is that genes do not control the mind. The boys will not get extreme ideas only by the genes. Even if they were not told what happened to their genetics and that their fathers were murdered. The main character of the book, Yakov Liebermann is a survivor of th e concentration camps and knows the infamous Joseph Mengele. He also knows what happened with twins in Auschwitz, and what role Mengele has played in it. Lieberman will do everything to stop Mengele to perform his horrible plans for he learned from history. He does everything to thwart the plans, so that history cannot repeat itself.Finally, everyone in the world has learned from the Second World War except Mengele. However, that Mengele comes up with this plan to the lines of Hitler and this strategy again, this but will never work. It is not possible to grasp the way Hitler did, namely power winning over and then make afraid. After the war there are innovations, more control and intelligence which make it all that much harder. It seems like Mengele played the role of the famous wizard Catweazle, who also suddenly comes into the modern era and has to deal with major changes.Mengele does not realize that the world has changed, that the world has learned from the horrors that have h appened. Mengele didn’t learn from the mistakes, and now he made a mistake again. Conclusion The conclusion is that in addition to DNA, there are other factors in the formation of someones personality. The plan was good, but he was too naive like to forget what happened in the past. He only thinks about his target, is concentrated too much, and lost the conspectus. Mengele is a dedicated man, but his plan would not work, that is clear.He has everything figured out, but he did not think about the opponents. The story is exciting and it draws you into the story quickly. But the points that make the story and the plan of Mengele are clearly difficult to get out. Furthermore, the book is well written with many exciting pieces that make you think, like why Mengele now need exactly the clones? Very interesting for a discussion, for instance. I must say that the story is very good, exactly what I expected of it. Sources: The boys from Brazil by Ira Levin. life of Hitler: http://nl . wikipedia. org/wiki/Adolf_Hitler.

Chikungunya virus Essays

Chikungunya virus Essays Chikungunya virus Essay Chikungunya virus Essay Abstraction The revival of Chikungunya virus ( CHIKV ) in several parts of Thailand runing from southern, northeast and North of Thailand with reported instances about 30,000 instances, get downing in October 2008 and ongoing until now ( November 2009 ) , has pointed out the public wellness concern. The chief clinical characteristics are onset of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia. The four about complete genome, representatives of 2008 and 2009, have been determined. Our survey shows that the closest related to the isolate in this eruption were the isolates from Kerela, South India of 2008 ( RGCB80, Accession No. GQ428212 ) demoing two coding part permutations: nsP2-L539S and E2-K252Q and the strain which predominant is ECSA strain, in contrast of the all old eruptions in Thailand which were Asiatic strain. Introduction Chikungunya Virus ( CHIKV ) is an enveloped, positive individual strand RNA virus with a genome of ? 11.8 kilobit [ 1 ] and belonged to the household Togaviridae and genus Alphavirus presently dwelling of 29 accepted members [ 2 ] . There is a 7-methylguanosine capped at the 5 terminal but a polyadenylated at the 3 terminal. The 5 two-thirds of the genomic RNA are responsible for the non-structural proteins. While the 3 tierce of the genomic RNA serves as the messenger RNA for the synthesis of the viral structural proteins [ 3, 4 ] . Harmonizing to the genomic organisation of other alphaviruses, the CHIK genome is acknowledged to be: 5 cap-nsP1-nsP2-nsP3-nsP4- ( junction part ) -C-E3-E2-6K-E1-poly ( A ) 3 . Alphaviruss have conserved sequences at the 5 and 3 terminals every bit good as the intergenic part. Among alphaviruses, conserved repeated sequence elements ( RSEs ) are besides observed in the 3 nontranslated part ( NTR ) . These conserved spheres play an of import func tion in the ordinance of viral RNA synthesis [ 5- 8 ] . CHIKV causes Chikungunya febrility ( CHIKF ) and chief clinical features include sudden oncoming of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia, which mostly affect the carpus, articulatio genus, mortise joint and little articulations [ 9 ] . The febrility about invariably precedes the roseola and joint hurting and has infrequently been reported as biphasic with return noted on the 4th or 5th twenty-four hours of unwellness [ 10, 11 ] . No studies of biphasic febrility were described during the 2005–2007 eruptions. In past eruptions, instances of feverish paroxysms in immature kids were besides reported [ 12 ] . Maculopapular and erythematous in character of the non-pruritic roseola is typically found and it will be seeable after infection for 2-5 yearss and may last up to 10 yearss. This roseola is distributed chiefly on the face, limbs and bole of the organic structure. Possibly the most important symptom of CHIKV infection is the te rrible articulation hurting that occurs with virtually every clinical instance [ 13, 14 ] . The patients who often reported disabling hurting that lasts for hebdomads or months have shown the articulations exhibiting enormous tenderness and swelling. Most infections wholly resolve within hebdomads or months but there have been documented instances of CHIKV-induced arthralgia prevailing for several old ages with up to 12 % of patients with CHIKV disease developing chronic articulation jobs [ 15- 17 ] . CHIKV was foremost described from the serum of a fevered homo during an eruption in Tanganyika ( now Tanzania ) in 1952–1953 during an epidemic of dengue-like unwellness [ 10 ] . Serologic and antigenic word picture of the isolates suggested that it was an alphavirus closely associated to Mayaro and SFV, while the initial appraisal was that the eruption was because of a dandy fever virus [ 18, 19 ] . Retrospective instance reappraisals have proposed that CHIKV epidemics occurred every bit early as 1779 but were often described inaccurately as dandy fever outbreaks [ 20 ] . During the sixtiess and 1990s, the virus was determined repeatedly from several states in Central and Southern Africa including Sudan, Uganda, Democratic Republic of Congo ( DRC, officially Zaire ) , the Cardinal African Republic ( CAR ) , Malawi, Zimbabwe, Kenya and South Africa. CHIKV has besides been isolated in western African states including Senegal, Benin, the Republic of Guinea, Cote dIvoire and Nige ria [ 21 ] . The virus is believed to hold originated in Africa and later was introduced into many parts of Asia [ 20 ] . Phylogenetic analysis of the CHIKV genome based on partial E1 sequences has identified 3 line of descents ; West African, Asian and East, Central and South African ( ECSA ) lineages [ 22 ] . In Africa, the virus is maintained through a sylvatic transmittal rhythm between wild Primatess and mosquitoes such as Aedes luteocephalus, Aedes furcifer, or Aedes taylori [ 23 ] while in Asia has been an urban transmittal rhythm, typically found in dengue-endemic countries and transmitted from human to human mostly by Aedes aegypti and, to a lesser extent, by Aedes albopictus [ 24 ] . The first CHIKV isolation in Asia was in Thailand in 1958 [ 25 ] and so other eruptions have been documented including Cambodia, Vietnam, Laos, Myanmar, Malaysia, Philippines, and Indonesia [ 23 ] Beginning in 1986, CHIKV outbreaks resurged with major disease bunchs documented in Senegal in 1986 and 1996/1997 [ 24 ] , Ivory Coast in 1996/1997 [ 26 ] , DRC during 1998–2000 [ 27 ] , Indonesia in 2003 [ 28 ] . Outbreaks occurred about continuously during 2004–2007 with 100s of 1000s of reported instances and new geographical countries involved [ 21 ] such as Kenya in 2004, Comoros in 2005 [ 29 ] , several Indian Ocean islands, in 2005, and India, in 2006-2007, which was an eruption of unprecedented magnitude [ 30 ] . Cases were besides reported in Europe ( UK, Belgium, Germany, Czech Republic, Norway, Italy, Spain and France ) , Hong Kong, Canada, Taiwan, Sri Lanka and the USA ; these were straight associated with the return of tourers from India and affected islands of the Indian Ocean [ 31 ] . The prevailing Aedes species in Madagascar and Reunion islands during 2005–2006 and in India in 2006/2007 was Aedes Albopictus [ 32 ] . The spread of chikungunya into rural countries during the ulterior phases of eruptions in India farther confirmed the potency of Aedes albopictus mosquitoes in conveying CHIKV [ 33 ] . These alterations were coincident with the outgrowth of a strain holding an alanine to valine permutation at codon 226 ( A226V ) of the envelope 1 ( E1 ) cistron in Reunion Island [ 34 ] and India [ 35 ] . This mutant is known to increase the transmissibi lity of the virus by Aedes albopictus [ 36 ] . This incident has been documented with the equid avirulent, Venezuelan equine phrenitis subtype ID viruses, where every bit small as 7 amino acid alterations can make epidemic forms of the virus responsible for immense eruptions [ 37 ] . The late September to October 2008, CHIKF eruptions have arisen in many southern states of Thailand particularly in Narathiwat, the southernmost state. There are plentifulness of Aedes Albopictus, the vector for CHIKV, in the plantation country, the common country of southern Thailand, and CHIKV was isolated from Aedes Albopictus in this outbreak country every bit good [ 38 ] . The suspension of CHIKF may be due to failure to observe low degree, continued transmittal in worlds, peculiarly because the symptoms may be mistaken for dandy fever febrility plus there is no accredited vaccinum or specific drug therapy available to bring around the unwellness, intercession relies upon vector control and minimising mosquito-human contact. Although there are several complete genomes of CHIK available in GenBank, the complete nucleotide sequence of CHIK distributing in Thailand is non available. In this survey, we conducted the about complete nucleotide sequence of virus isolated from four serum in 2008 and 2009, from Narathiwat state, the southernmost of Thailand and Bangkok where forbearance returned back from Nakhonsrithammaraj, the South of Thailand, inside informations were provided in table 1. In add-on, the phyletic beginning and the diverseness of the CHIKV strains responsible for reemergence in Thailand are besides considered. Method RNA extraction and RT-PCR CHIKV have been isolated straight from the patient s sera or from cell civilization which came from Vero cell at the first transition and the inside informations of sample were provided in table 1. Viral RNA were extracted by Viral Nucleic Acid Extraction Kit ( RBC Bioscience, Taiwan ) harmonizing to maker s process followed by contrary written text polymerase concatenation reaction ( RT-PCR ) utilizing Superscript III Pt One-Step Quantitative RT-PCR System ( Invitrogen, Carlsbad, CA, USA ) . A reaction mixture consisted of 2 ?l of extracted RNA, 5 ?l of 2x reaction mixed, 0.1 ?l of superior contrary RNA polymerase III Pt Taq polymerase, 0.5 ?M of each primer, and 6 ?l with nuclease-free H2O. The RT measure and PCR elaboration were performed in a Eppendorf Mastercycler personal ( Eppendorf, Hamburg, Germany ) at one time under the undermentioned conditions: contrary written text at 50 C for 30 min ; later initial denaturation at 95 C for 3 min ; followed by 40 rhythm of denaturation at 95 C for 1 min, primer tempering at 55 C for 1 min, and extension at 72 C for 1.30 min ; and concluding extension at 72 C for 7 min. All primers were used as show in table 2 which was designed towards S27 strains ( GenBank accession no. AF369024 ) [ 35 ] . Then the amplified PCR merchandises were analyzed by cataphoresis with 2 % -agarose gel in TBE buffer and stained by ethedium bromind, the expected set for the merchandise were visualized under UV visible radiation, excised from the gel and purified with the QIAquick Gel Extraction kit ( RBC Bioscience, Taiwan ) following the maker s instructions. The purified PCR merchandises were so used for direct sequencing by First BASE Laboratories SDN BHD ( Selangor Darul Ehsan, Malaysia ) . Table 1 Sample inside informations used in this survey sample codification day of the month of aggregation topographic point GenBank Acc No sample type CU-Chik661 2009 Narathiwat biological sample CU-Ckik009* 2009 Capital of thailand biological sample CU-Ckik10 2008 Narathiwat biological sample CU-Chik683 2009 Narathiwat virus isolate *patient returned from Nakhonsrithammaraj, the state in the South of Thailand. Table 2 Primers used for whole genome sequencing fragment cistron primer ( a ) Sequence ( 5 to 3 ) 1 5NC 18F CACGTAGCCTACCAGTTTCTTA nsP1 871R ATGGAACACCGATGGTAGGTG 2 nsP1 616F AACCCCGTTCATGTACAATGC nsP1 1435R CGGTACCACAAAGCTGTCAAAC 3 nsP1 1317F CACTGACCTGCTGCTGTCTATG nsP2 2130R AGTCCTGCAGCTTCTTCCTTC 4 nsP1 1412F CGAGTTTGACAGCTTTGTGGTA nsP2 2227R ATGACTGCAATTTTGTATGGGC 5 nsP2 1908F CAATCTCGCCTGAAGACTTCC nsP2 2709R TCCACTACAATCGGCTTGTTG 6 nsP2 2530F GTGCGGCTTCTTCAATATGATG nsP2 3343R TCCAGGCCTATTATCCCAGTG 7 nsP2 2577F AACATCTGCACCCAAGTGTACC nsP2 3504R GTCTCCTGTTGGCCGGTATAAT 8 nsP2 3332F TAATAGGCCTGGAGGGAAGATG nsP3 4134R CTACGCACTCTTCATCGTTCTT 9 nsP2 3885F GAACGAGTCATCTGCGTATTGG nsP3 4725R ATATCTCTGCCATATCCACTGC 10 nsP3 4458F TCTTTACAGCCATGGACTCGAC nsP4 5874R TCTACTTTGCGCGACTGATACC 11 nsP4 5630F CCCAGTATTCTTGGTTGCATG nsP4 6380R AAAACAGCACGCTTACCACG 12 nsP4 6184F AAAACAGCACGCTTACCACG nsP4 6936R AACTTGAAGCGCGTACCTGTC 13 nsP4 6732F TCATAGCCGCACACTTTAAGC nsP4 7495R AGGACCGCCGTACAAAGTTAC 14 nSP4 7278F GCAGGTGACGAACAAGATGAG C 8034R CCGCTTAAAGGCCAATTTG 15 C 7910F TCGAAGTCAAGCACGAAGG E2 8670R GTCTGTCGCTTCATTTCTGATG 16 E3 8459F TGCTTGAGGACAACGTCATGAG E2 9240R TTTGTGATTGGTGACCGCG 17 E2 9093F AGTCCGGCAACGTAAAGATCAC 6K 9861R AAAGGTTGCTGCTCGTTCCAC 18 E2 9648F AGTTGTGTCAGTGGCCTCGTTC E1 10403R TAAAGGACGCGGAGCTTAGCTG 19 E1 10145F ACAAAACCGTCATCCCGTCTC E1 11158R TGACTATGTGGTCCTTCGGAGG 20 E1 10959F CAGCAAGAAAGGCAAGTGTGC 3NC 11802R CTCCTACGTCCCTGTGGG The primers for the fragment 1-19 and the forward primer for fragment 20 are used from the published primers [ 36 ] and the contrary primer for fragment 20 was designed in this survey. Assembly of Genome Sequences and Sequence Analysis The genome sequences were analyzed utilizing the BLAST plan available in GenBank ( hypertext transfer protocol: //blast.ncbi.nlm.nih.gov/Blast.cgi ) . Then they were edited and assembled by utilizing CHROMASLITE ( v.2.0 ) and SeqMan ( DNASTAR, Madison, Wis. , USA ) . All sequences were aligned by utilizing Clustal X version 1.83 and phyletic trees were constructed utilizing the neighbor-joining method and Kimura s two-parameter with 1,000 bootstrapping method implemented in MEGA3.1 plan. Consequence Complete genome analysis of CHIKV in Thailand We determined the about full-genome sequences of four CHIKV isolates which were representatives of 2008 and 2009 in Thailand and the inside informations are provided in table1. The lengths of genome sequence of four isolates presented in this paper were 11,811 base brace except isolate CU-ChiK661 was 11,738 base brace. Every isolates shared the same length of big two ORF ; non-structural part 7422 bases ( 2,474 aa ) and structural part 3744 bases ( 1248 aa ) and besides shared 65-nucleotide junction between these two open reading frame excepting stop codon of the non-structural of unfastened reading frame and get down codon of the structural unfastened reading frame. The 5UTR ended at nucleotide place 62 for CU-ChiK661 and 76 for others. The 3UTR part started at nucleotide place 11,299 for CU-ChiK661 and 11,314 for others. Then they were aligned with complete 23 genome sequences available in GenBank. Overall, genome constructions of these four isolates were consistent with old work [ 41 ] . The isolates in this survey were found really closely related demoing 99.79-99.89 % individuality with one another and had an mean whole genome nucleotide individuality of 97.0 % with the S27 paradigm. The isolate which were near related with our isolates was the isolate from Kerala, South India: RGCB80, Accession No.GQ428212 demoing an mean 99.72 % individuality. The most closely related to S27 paradigm CU-Chik661 was the closest one to S27 strain. In the non-structural part showed 34 aa alteration ( 1.37 % ) lined in nsP1 nine aa alteration ( 1.68 % ) , nsP2 6 aa alteration ( 0.75 % ) , nsp3 11 aa alteration ( 2.07 % ) , and nsP4 7 aa alteration ( 1.14 % ) . The nsP3 showed the highest ratio alteration while the nsP2 showed the lowest ratio alteration which correlated with old survey [ 36 ] . When it comes to structural part, ChiK661 exhibited 25 aa alteration ( 2.00 % ) arranged in C 3 aa alteration ( 1.15 % ) , E3 1 aa alteration ( 1.56 % ) , E2 15 aa alteration ( 3.55 % ) , 6K 2 aa alteration ( 3.27 % ) , and E1 4 aa alteration ( 0.91 % ) ( table3 ) . Table 3 Comparison of amino acerb permutations identified in Thailand with that of S27 and other Indian isolates in 2007 and 2008 Region polypeptide place pritein place S27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsp1 29 29 Phosphorus . . . . Second . 105 105 Gram . Roentgen . . . . 128 128 Thymine K K K K K K 172 172 Liter Volt Volt Volt Volt Volt Volt 186 186 Nitrogen . . . . Calciferol . 234 234 Tocopherol K K K K K K 256 256 Tungsten . Roentgen . . . . 376 376 Thymine Meter Meter Meter Meter Meter Meter 383 383 Meter Liter Liter Liter Liter Liter Liter 384 384 I Liter Liter Liter Liter Liter Liter 481 481 Thymine I I I I I I 488 488 Q Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 507 507 Liter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 531 531 Calciferol Gram . . . . . nsp2 583 48 Volt A . . . . . 589 54 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 614 79 Phosphorus . . . . Second . 716 181 Volt A . . . . . 864 329 K Tocopherol . . . . . 909 374 Hydrogen Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1074 539 Liter Second Second Second Second Second Second 1117 582 C Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1118 583 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1328 793 A Volt Volt Volt Volt Volt Volt nsP3 1428 95 K Q . . . . . 1508 175 Volt I I I I I I 1534 201 Second . Gram . . . . 1550 217 Yttrium Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen 1659 326 Phosphorus Second Second Second Second Second Second 1664 331 Volt A A A A A A 1670 337 Thymine I I I I I I 1671 338 Thymine . . . . Meter . 1685 352 K Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1709 376 I Thymine Thymine Thymine Thymine Thymine Thymine 1715 382 A Thymine Thymine Thymine Thymine Thymine Thymine 1794 461 Liter Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus 1795 462 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1804 471 Phosphorus Second Second Second Second Second Second nsP4 1938 75 Thymine A A A A A A 1945 82 Roentgen . . . . Roentgen . 1950 87 Yttrium . . Hydrogen . . . 2117 254 Thymine A A A A A A 2157 294 Volt A . . . . . 2363 500 Q Liter Liter Liter Liter Liter Liter Region polypeptide place pritein place s27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsP4 2377 514 I Thymine Thymine Thymine Thymine Thymine Thymine 2418 555 Volt I I I I I I 2458 595 Nitrogen . . . . K . 2463 600 Roentgen . . . . I . 2467 604 Volt I I I I I I 2468 605 Thymine . . . . Second . 2469 606 Liter . . . . Meter . mirid bug 23 23 Phosphorus Second Second Second Second Second Second 27 27 Volt I . I I I I 28 28 Roentgen . Thymine . . . . 63 63 K Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen E3 284 24 I Thymine Thymine Thymine Thymine Thymine Thymine 290 30 K . . . Roentgen . . E2 382 57 Gram K K K K K K 399 74 I Meter Meter Meter Meter Meter Meter 404 79 Gram Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 409 84 F . . . Liter . . 485 160 Nitrogen Thymine Thymine Thymine Thymine Thymine Thymine 489 164 A Thymine Thymine Thymine Thymine Thymine Thymine 506 181 Liter Meter Meter Meter Meter Meter Meter 519 194 Second Gram Gram Gram Gram Gram Gram 536 211 I Thymine Thymine Thymine Thymine Thymine Thymine 554 229 Volt . I . . . . 576 251 Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 577 252 K Q . Q Q Q Q 592 267 Meter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 624 299 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 632 307 Q . . . Roentgen . . 637 312 Thymine Meter Meter Meter Meter Meter Meter 669 344 A Thymine Thymine Thymine Thymine Thymine Thymine 675 350 Gram . Second . . . . 700 375 Second Thymine Thymine Thymine Thymine Thymine Thymine 711 386 Volt A A A A A A 6K 756 8 Volt I I I I I I 802 54 I Volt Volt Volt Volt Volt Volt 813 65 Volt . A . . . . E1 1035 226 A Volt Volt Volt Volt Volt Volt 1078 269 Meter Volt Volt Volt Volt Volt Volt 1093 284 Calciferol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1113 304 Phosphorus . Liter . . . . 1131 322 Volt A A A A A A 1242 433 C Roentgen . . . . . Non-structural part Compared to S27 and, the CU-Chik661, CU-Chik009, CU-Chik10 and CU-Chik683 isolates have shared 26 permutations in the non-structural part: nine in nsP1 ( T128K, L172V, E234K, T376M, M383L, I384L, T481I, Q488R, and L507R ) , five in nsP2 ( S54N, H374Y, C582Y, S582N, and A793V ) , eleven in nsP3 ( V175I, Y217H, P326S, V331A, T337I, K352E, I376T, A382T, L461P, S462N, and P471S ) and six in nsP4 ( T75A, T254A, Q500L, I514T, V555I, and V604I ) as shown in table3. Most of these alterations were besides found in other isolates from Indian Ocean and Reunion isolate in 2006 and 2007, isolates from Kerala, South India in 2006-2008 and other parts of the universe. Interestingly, there was opal stop codon ( UGA ) at nsP3 codon 524 in the present isolates while S27 and Ross were non. This opal halt codon was besides observed in related alphavirus and old reported CHIKV isolates every bit good [ 35 ] . It is believed to modulate the look of nsP4, the putative RNA polymerase, by read-through mechanism [ 2, 39 ] Additional particular alterations were besides observed in ChiK10 ( nsP1-P29S, nsP1-N186D, nsP2-P79S, nsP3-T338M, nsP4-N595K, nsP4-R600I, nsP4-T605S, and nsP4-L606M ) and ChiK661 ( nsP4-Y87H ) . There was besides alone nucleotide permutation to the CU isolate which was non-synonymous alteration A6811G lined in nsP4 part. Structural part When analysing the amino acerb alteration of the structural protein 24 place were found to be common for the four isolates: three in C ( P23S, V27I and K63R ) , one in E3 ( I24T ) , 15 in E2 ( G57K, I74M, G79E, N160T, A164T, L181M, S194G, I211T, K252Q, M267R, S299M, T312M, A344T, S375T, and V386A ) , two in 6K ( V8I and I54V ) and four in E1 ( A226V, M269V, D284E, and V322A ) The lone one isolate which had specific alteration was ChiK009 demoing three specific aa place alterations ( E3-K30R, E2-F84L and E2-Q307R ) At the nucleotide place 9138, there was a alone event to the CU isolate demoing the same base as S27 and Ross strain while the remainder of other sequences antecedently reported had changed from T to C. 5 and 3 NTRs The 5 NTR of all four isolates were found to portion similarity with one another uncovering the mutant at place 68 from G to T in comparing to S27 which were besides detected in all the recent isolates. Merely did CU-Chik10 hold a mutant at nucleotide place T64A. There was no interpolation or omission has been observed. Within the 3UTR, sequences in this survey revealed the omission of a stretch 14 bases of 19 bases at place 11,369-11,342 compared to S27 except CU-Chik661 showed merely one A omission. This 14-A losing events besides showed in 2006 Indian Ocean isolates [ 35 ] . Phylogenetic analyses Fig.A1 illustrated the phyletic tree base on full genome analysis. CU isolates ( CU-Chik009, CU-Chik10, CU-Chik683 and CU-Chik661 ) arranged closest to isolates from Kerala, South India. Furthermore, they were crusted together with isolates during 2006 reunion eruption and 2007-2008 Indian eruption and related isolates. We besides determine extra E1 partial genome to analyse phyletic beginning as it is of import in phyletic analysis and there is more available sequence of this part including Asiatic and West-African strain. The phyletic tree based on E1 partial genome displayed in fig.A2. It revealed that all isolates in this survey were grouped in ECSA phylogroup. This determination was non the same phylogroup doing the eruption in 1958 in Thailand which was assigned in Asiatic strain. Discussion The first CHIKV described in Thailand was in 1958 in Bangkok [ 25 ] which was subsequently confirmed to be an Asiatic strain. [ 22 ] After that there were still a cyclicity of outgrowth of CHIKV in Thailand demoing a spread of 2-18 old ages: Prachinburi ( 1976 ) , Surinn ( 1988 ) , Khon Khen ( 1991 ) , Loei and Prayao ( 1993 ) , and Nongkhai and Nakorn Sri Thammaraj ( 1995 ) . During those outgrowths, the CHIKV all happened to be Asiatic strain [ 22 ] . CHIKV is presently doing one of the big eruptions reported in the past 50 old ages as in October 2008, bunch of febrility, roseola and terrible arthralgia was detected in one small town at Laharn wellness centre in Narathiwat and so chikungunya was suspected and confirmed subsequently. CHIKV has been distributing to next state of Narathiwat and the close state including Songkhla, Pattani and Yala by detecting several thousand instances reported in each country. Not merely has CHIKV been administering in the nearby country of Narathiwa t but besides go arounding in the other parts of Thailand including sou-east, cardinal, north and E of Thailand demoing more than 30,000 septic instances. The chief factor of distributing across the country is believed to be importing by travellers. This magnitude of the epidemics has arisen concernment of the public wellness of Thailand. As CHIKF was non a notifiable disease in Thailand, therefore the Bureau of Epidemiology had included CHIKF is the latest notifiable disease and launched in November 2008 ( inactive surveillance countrywide ; all gov. infirmaries and some private ) [ 40 ] . This survey revealed the high degree of preservation of this RNA virus within a peculiar eruption that has been of considerable involvement during the patterned advance of 2008-2009 Thailand epidemics. As observed in old findings of samples collected during an on-its-own eruption, isolate sequences showed merely rare alterations stand foring expected degrees of familial impetus connected with an RNA genome. However, some given mutants were identified that may hold an association with samples collected from patients stand foring more terrible unwellness. Our survey represents the first analysis, to our cognition, of intra-outbreak of CHIKV in Thailand of the molecular degree. Our phyletic analyses placed on partial glycoprotein E1 sequences confirmed that CHIKV distributing in Thailand was caused by the same strain on Reunion, Seychelles, Mayotte, Madagascar, Mauritius, Indian Ocean, and India, and showed that this strain is related to East- , Central- and South-Africa isolates non th e Asiatic strain as old eruption in Thailand. In add-on, E1-226 was the lone genotype observed during this eruption. Previous surveies showed that the mutant of amino residue 226 of E1 genome of SFV was observed to let go of the cholesterin dependance of the virus [ 41, 42 ] which might convey an advantage to virus in mosquitoes which are cholesterin auxotrophs, therefore CHIKV might hold the favour from this mutational alteration every bit good. From all sequence of CHIKV except S27 and Ross strains have shown opal halt codon ( UGA ) at nsP3 codon 524. Restricting the figure of transitions is the key because the infecting viral population may maintain up a correspondence to a quasispecies [ 43, 44, 45 ] . Repeated in vitro transitions could move as a filter on this population. For case, the presence in S27 of an Arg codon alternatively of the opal halt codon in other isolates is possibly explained by legion in vitro transitions of S27, as development of opal to Arg was observed by experimentation in ONN viruses [ 46 ] There is no aminic acid alteration detected among this eruption that is unambiguously associated with the Central/East African genotype from which the strain doing the 2008-2009 epidemics evolved. However, there are two alterations, one at the nsP2-L539S and one in the E2-K252Q that about alone to these isolates irrespective of three isolates from Kerala, South India, either alteration alters the hydrophobicity and charge of the amino acid incorporated but the biological relevancy of these alterations can merely be speculated. Chik10 had revealed the most alterations compared to three isolates and Chik10 was the lone sample collected in 2008 and it had specific alterations that have nt shown in other isolates. Therefore those alterations might non remain circulate in this eruption or it was non the strain which predominate. Although CHIKV eruption has happened in Thailand since 2008, it is still ongoing circulate in several parts of Thailand so the farther probe should be considered.

Health and safety in the health and social care workplace Essay Example

Health and safety in the health and social care workplace Essay Example Health and safety in the health and social care workplace Essay Health and safety in the health and social care workplace Essay Health and safety in the wellness and societal attention workplace Contentss Introduction Task-2 2.1 How information from hazard appraisals informs care be aftering for persons and organisational determination doing about policies and processs 2.2 The impact of one facet of wellness and safety policy on wellness and societal attention pattern and its clients 2.3 Discuss how quandary encountered in relation to implementing systems and policies for wellness, safety and security may be addressed 2.4 The effects of non-compliance with wellness and safety statute law in a wellness and societal attention work topographic point Task-3 3.1 How wellness and safety policy and patterns are monitored and reviewed 3.2 The effectivity of wellness and safety policies and patterns in the workplace in advancing a positive wellness and safety civilization 3.3 My part to puting the wellness and safety demands of persons at the Centre of pattern Decision: Introduction Health and safety demands are the basic right of every human being. Therefore, wellness and societal attention organisation must guarantee wellness and safety demands to their clients every bit good as their employees working for them. Each organisation must hold information for pull offing the hazards which can do injury to their workers or the clients. To supply safety updates to their clients at first, hazard factor appraisal should be taken topographic point. By making hazard assessment the authorization can be able to cognize which hazards can harm their service users. With aid of the hazard assessment the authorization can take attention planning and appropriate determinations for their client’s safety. Therefore, it helps to present appropriate statute laws or policies. To supply the best safety steps, the authorization must be on a regular basis checked these policies. By supervising and reexamining the patterns, we can guarantee fewer accidents in the workplace. Effec tive wellness and safety policies can convey better repute of the organisation and additions trust from their clients. Task-2 2.1 How information from hazard appraisals informs care be aftering for persons and organisational determination doing about policies and processs ’Risk assessments’ inform appropriate ’care planning’ for the persons and affect changeless monitoring of alterations if it is needed. Harmonizing to the definition, attention planning is a record of demands, ends and intercessions, puting out actions for run intoing the person’s demands who uses the services sing their physical wellness, personal state of affairs, household relationships, and specifying how these demands affect their wellness. Actually attention programs involve the countries of the user’s physical wellness, mental wellness province, disablement, adjustment and employment, fundss, inside informations of kids or immature people ( under 18 ) life with the patient who uses our services or with whom the patient who uses our services has important contact, societal activities, spiritualty and ethnicity, gender, civilization, carers views about the fortunes of the individual they care for, carers assessment, where apposite. Hazard appraisals is one of the of import tools of determination devising, which promotes the promotion and usage of logical methods for bettering decision-making in wellness and societal attention workplaces. By executing these appraisals we can really cognize the jeopardies in the workplace and find the client’s demands and do appropriate determinations harmonizing the demands. 2.2 The impact of one facet of wellness and safety policy on wellness and societal attention pattern and its clients There are many characteristics of health and safety policy’ on wellness and societal attention pattern and its client such as workers safety consciousness, effectivity of review, authorities steps etc. Among them review has a outstanding influence on health and societal attention practice’ . Below we precis some research documents on the impact of review of health and safety policy on wellness and societal attention practice’ and its client from U.K, which have applied backsliding analysis to aggregate informations at industry degree. Bartel and Thomas ( 1985 ) ten included reviews, review punishments, and the lost workday hurt rate to project a coincident equation theoretical account. They collected industry-level informations for the period 1974 to 1978. Their informations showed that though greater frequence of reviews gave rise to increased wellness and safety conformity, but this had non important consequence on cut downing hurt rates. Viscusi ( 1986 ) xi analyzed hurt rates by sing different factors such as control of expected mulcts, industry, twelvemonth and non-health and safety variables that could hold resulted in alterations in the hurt rate. He used industry-level informations for the clip period 1973to 1983. He found important effects of wellness and safety reviews on hurt rates. Furthermore, he did non happen any grounds in favour of ground that increased punishments would do lower rate of hurts. Gray and Jones ( 1991 ) twelve showed that farther wellness reviews in bring forthing workss reduced the figure of disputes of worker exposure limitations. They besides found first wellness review as the strongest impact factor, and they besides matched all Occupational Safety and Health Administration ( OSHA ) wellness reviews for single fabrication workss which were inspected during the period of 1972 to 1983. 2.3 Discuss how quandary encountered in relation to implementing systems and policies for wellness, safety and security may be addressed In the workplace, de facto communicating of wellness and safety is normally faced with a wide scope of predicaments andproblems. However, to guarantee the full procedure effectual, assorted factors should be considered, including hazard to others, hazard to self, resource illations, risk-benefit analysis, and divergent precedences between stakeholders, either external or internal. Care be aftering ensures the sound execution of the safetypolicy through effective scheme, including execution of the rules of wellness and security and optimisation of the wellness of employees. To make a safe and healthy environment at different degrees such as single, squad, or organisational degrees, organisations should prevail on understanding, duties, preparation, performs, and how different groups, persons and bureaus merge to each other. Organization should supervise and assesses wellness and safety policies, and execution procedure via review and scrutinizing the workplace. Management has to do ce rtain that all employees are trained on wellness and safety issues, such as cleanliness which is indispensable in avoiding nutrient toxic condition, conforming of effectual process of disposing of waste etc. that may happen during working period. Like, banana Peel should non be thrown on the floor because it can do deadly accident to other employees. There are other critical issues that can significantly diminish the menaces. In this manner quandary can be addressed. 2.4 The effects of non-compliance with wellness and safety statute law in a wellness and societal attention work topographic point Non- conformity with wellness and safety or breach of Health and Safety Regulations’ is a act of misconduct and can be result as in the Company, Corporation, or an single director etc. , being accused by the pertinent Health and Safety Enforcement Authority’ and if the individual or organisation is found guilty he/she can be fined or imprisoned. The individual who is guilty ( every bit good as the organisation ) can be charged under section 37’ of the Health and Safety at Work Act 1974’ . Each breach whether it is intentionally go againsting the fundamental law or by being highly lax in making judicial responsibilities that result in lives in danger, can take to limitless mulcts and/or imprisonment. Health and safety enforcement governments can publish an promotion or interdiction notice to the workplace, apart from prosecuting the employer. Generally, an promotion notice by and large requires a improvement to be made in 21 yearss can be extended if needed. But in an exigency instance, it should be improved instantly. Non-compliance with a notice can bring forth prosecution in the magistrate’s courts’ . A worker injured at work or the client who is affected, fundamentally the victim can action the organisation or the guilty individual for amendss if the individual is inattentive in any manner in supplying safe and healthy provinces. Those found blameworthy are accountable for imprisonment and mulcts. In add-on, the Company Directors Disqualification Act 1986’ , subdivision 2 ( 1 ) ’ , certifies the tribunal to censor an single declared of an offense in association with the direction of the company. This power is implemented at the discretion of the tribunal and needs no extra grounds or probe, therefore ensures wellness and safety. The offense of any decease is chargeable by an limitless mulct and a maximal penalty of life imprisonment. Task-3 3.1 How wellness and safety policy and patterns are monitored and reviewed Prevention is ever better than remedy. Agreements for analyzing and appraising the wellness safety precautional steps can be introduced with the aid of hazard appraisals which should be antecedently done and do certain that the efficaciousness of these steps are maintained decently and the hazard is under controlled. Hazard appraisals should non be practiced one time for all, it should be monitored on a regular basis for the undermentioned reasons- many alterations occur in the work topographic point so new alterations should be monitored, if a new step has been introduced such as new equipment or stuffs so new working conditions should be applied in order to forestall any hazard by them. If it is non measured so accident will happen or near miss’ -an accident which antecedently didn’t occur but with the new alteration it happened will ensue in hurt or life hazards. The board can guarantee some nucleus actions as a monitoring- preparation and care programmes can be held and incident informations such as decease rates, inadvertent rates can be collected, periodic hazard Appraisals and fecundity of the preventative steps can be audit, influence of alterations such as new equipment debut or work procedures or critical wellness and safety failures should be presented in no clip and appropriate steps should be taken. 3.2 The effectivity of wellness and safety policies and patterns in the workplace in advancing a positive wellness and safety civilization Guaranting health and safety’ in the workplace should non be seen as an administrative liability: it offers some noteworthy chances or effectivity in the work topographic point. Benefits from the wellness and safety policies we can acquire the followerss: Reduced costs:If wellness and safety statute laws are antecedently taken by the organisation so we can certainly cut down some unwanted costs which can happen if any inadvertent incident happens. Reduced hazards:We can surely cut down hazards in the organisation by the hazard appraisals which is a portion of wellness and safety pattern. Unwanted hazards can be prevented by the hazard appraisal. Lower employee absence and turnover rates:If we can non guarantee safety to our employees who work for the organisation so they will be less sincere to the work topographic point and absence and turnover rates will be higher. Fewer accidents:If we can guarantee adequate safety in the workplace so we can certainly cut down the accidents. So it means we can hold fewer accidents compare to old if safety steps are improved and checked on a regular basis in a everyday mode. Lessened menace of legal action:By the decrease of fewer accidents or hazards in the work topographic point we can decrease our menace of legal action. It is known to everybody that legal punishments are truly high of the carelessness in the wellness attention workplace, so taking appropriate preventative steps we can avoid those punishments. Better repute among clients and communities:If we can guarantee a safe wellness attention Centre to our clients and workers so the repute of our organisation will be higher and we can derive the trusts of our clients and guarantee them maximal client satisfaction. 3.3 My part to puting the wellness and safety demands of persons at the Centre of pattern I act as an of import individual in my Centre of pattern in puting wellness and safety demands and my ain parts to puting safety of persons are given below- At first, I merely go through the hazard appraisals of my workplace and happen out where certain hazards can be occurred. Based on the hazard appraisals I analyze which sort of safety steps should be taken attention of. If new alteration is introduced to my workplace so doing an appropriate determination based on the alteration should be practiced and if any new bars is needed so I inform the senior authorization to take appropriate actions. I besides collect incidental records such as decease records, inadvertent records and do some appropriate bars to get the better of the accidents. Decision: Every wellness and societal attention organisation must guarantee appropriate wellness and safety steps to their service users every bit good as their employees. Health and safety demands is a basic demand of any individual so taking it lightly is a serious offense. Not merely wellness attention workplace should take it earnestly but besides other organisations should be able to guarantee their safety bars. For doing a safe workplace one should first take topographic point hazard appraisals to pull off the hazards and supply regular updates on relevant issues. If any workplace is failed to supply their clients plenty safety so they will hold to give punishment on their actions. It is known to everyone that safety issues can convey approximately highest punishments to the authorization such as mulcts and maximal imprisonment. Effective wellness and safety policies and patterns can do a positive wellness and safe civilization and brings fewer accidents, reduces costs and hazards, lesse ns legal punishments, diminishes the employee absence and turnover and creates better repute of the workplace among the service users and the society. Mention: Mason, Diana J, Judith K Leavitt, and Mary W Chaffee.Policy A ; Politicss In Nursing And Health Care. St. Louis, Mo. : Elsevier/Saunders, 2012 Collins, Suzan.Health And Safety. London: Jessica Kingsley, 2009 Barlett, Donald L, and James B Steele.Critical Condition. New York: Doubleday, 2004 Chemical bond, Richard G, George S Michaelsen, and Roger L DeRoos.Environmental Health And Safety In Health-Care Facilities. New York: Macmillan, 1973 Farley, Donna.Measuring Patient Safety Practices And Outcomes In The U.S. Health Care System. Santa M Fottler, Myron D, Naresh Khatri, and Grant T Savage. Strategic Human Resource Management In Health Care. Bingley, UK: Emerald, 2010. Print. onica, CA: RAND, 2009. Roth, Herbert H, Erwin S Teltscher, and Irwin M Kane.Electrical Safety In Health Care Facilities. New York: Academic Press, 197. OSHA In The Real World. Santa Monica, Calif. : Merritt Pub. , 1996 Hall, Mark A, and Sara Rosenbaum.The Health Care Safety Net In A Post-Reform Universe. New Brunswick, N.J. : Rutgers University Press, 2012 [ 1 ]

Cambrian Explosion Research Paper Example | Topics and Well Written Essays - 1500 words - 2

Cambrian Explosion - Research Paper Example Some of the animals with basic animal bodies include arthropods such as insects, crustaceans, and trio-bites, cnidarians like jellyfish and corals, mollusks such as shellfish and squids, echinoderms like sea urchins and sea star, and chordates such as vertebrates. The Cambrian exposition occurred during the Cambrian period that began 570 million years ago and ended 510 million years. According to Meyer et al. (2001), the Cambrian exposition occurred within a window of 20 to 40 million years during the Cambrian period. According to BBC, (2015), the Cambrian period began 545 million years ago and ended 495 million years ago. The Cambrian period was characterized by the sudden emergence of living organisms in the sea. Although geologists are lucky to identify some Cambrian fossils, there was no life on the land. According to Darwin’s theory, the Cambrian exposition is based on the existence of changing environmental conditions that cause genetic modification of genes. The major cause of the Cambrian exposition is believed to be a rapid increase in the oxygen level in the atmosphere. An increase in oxygen level in the atmosphere occurred approximately 2.3 or 3 million years when numerous microorganisms released oxygen to the atmosphere through photosynthesis. The second oxygen increase event occurred approximately one billion years ago and resulted in the development of various complex organisms during the Cambrian period. The link between the increase in oxygen levels and development of complex organisms is confirmed by various past events. For instance, the oxygen concentration is believed to have increased from 10 % to 21% in the past 425 million years. The event resulted in the evolution of vertebrates thus attaining essential features. Secondly, high oxygen concentration level in the atmosphere resulted in an increase in insect size (Koch & Britton, 2009). According to Penumaka (2011), the earth was covered by glacier 580 million years ago thus

Service Management Essay Example | Topics and Well Written Essays - 1250 words

Service Management - Essay Example The organizations that deal in banking, hospitality and consultancy amongst others are all included in the services sector (1). The importance of services in the industrialized economies has constantly been ignored. There are many services in that are not taken in to account, mainly in the agricultural and the industrial sector, which are not viewed as contributors of services to the economies. However, they contribute to the service sector in an unseen manner (2). Consumers are usually concerned with the amount of satisfaction derived from the services offered. It is important for service providers to understand that value is of utmost importance if they have to excel in the business of service marketing. The service perspective is important in the accomplishment of satisfaction amongst the consumers. This is an aspect of marketing whereby marketers ensure that a number of services are provided for the customers to make a choice. This is important for the business in order to ensure that it has a competitive advantage over other service providers, thereby increasing the sales volume. Service perspective involves the engagement of people who are capable of offering the most efficient services to customers in order for them to get motivated to come back for more. This is a significant tool for ensuring that customers build trust in the service provider. Apart from increasing the competitive advantage of the service provider, it helps in encouraging the customers to buy more and also encourage new customers to the business. The reputation of the business is improved, and customers do not complain in regard to the services offered to them. Adopting the service perspective is significant in reducing the cost of production, since acquiring new customers is usually difficult and costly. It therefore plays a significant role in maintaining

Use of Visual Aides in the Modern Classroom Essay Example for Free

Use of Visual Aides in the Modern Classroom Essay Visual aides have become important to the learning processes of children in all grades of school. From simple skits to enhanced computer calculations and comparisons, teachers everywhere are learning the power of having their students visualize and take part in what they are expected to learn. This process is a great departure from the classic learning model of reading along and taking notes, so it takes some teachers and faculty a while to accept and learn new styles of teaching. The three articles that I have chosen show the value of visual aides in the classroom, but also note the difficulties of changing long held educational beliefs. â€Å"You Gotta Have Art! †, by Roger Glass and Priscilla Nemeth, describes the impact of visual learning in classes around the United States. For example, in order to visualize â€Å"natural environments found in Florida†, students were prompted to paint a mural on a school wall showing what they had learned in their science class. The mural was a way to learn as well as a point of pride to the children who helped create it (Glass Nemeth, 2003, para. 5). Other schools use â€Å"a print of the city† to teach local history and geography, instead of simply using a plain map. The print allows children to see the buildings and sites that they discuss in class, rather than just have the areas pointed out to them on a basic city map that includes only streets and symbols (Glass Nemeth, 2003, para. 3). The results have been more than anyone could have expected. Attendance and discipline have improved in the schools that promote visuals in the classroom, and scores on standardized tests have risen dramatically (Glass and Nemeth, 2003, para. 2). It is apparent from this article that allowing children to see what is special about a subject, and also take part in projects that they can be proud of, encourages them to come to school interested and ready to learn. â€Å"Talking Science, Modeling Scientists†, by Elizabeth Edmondson, William H. Leonard, Chris Peters, and Anna O. Baldwin, describes a program in place in South Carolina schools that lets the students learn visually in class and then share the knowledge with students in other schools who are learning the same lesson. Students were taught a science unit on electric circuits by such means as â€Å"lighting a bulb with a battery, bulb, and wire, constructing a flashlight using a series or parallel circuit and switch, and designing and wiring a simple cardboard house† (Edmondson, et al. , 2006, p. 29). The learning did not stop there. Students learned to write about what they had visually learned, and then shared the information with student partners over a special system. (Edmondson, et al. , 2006, p. 30). This system allowed students from each school to post questions and answers to each other by means of a dedicated message board (Edmondson, et al, 2006, p. 30). Students were encouraged to â€Å"buddy up† and work on projects together (Edmondson, et al, 2006, p. 30). Also, those having trouble learning were paired with those who had a mastery of the subject, so long distance peer tutoring occurred as well (Edmondson, et al, 2006, pg. 31). Teachers reported that this system of visual and hands on learning much improved the students’ comprehension levels and incidently improved their writing skills due to the reports that they posted (Edmondson, et al. , 2006, p. 31-32). This project not only serves as an interest to children who easily catch on to the lesson, but it also gives them a chance to help fellow students who are struggling. Achievement is possible for all with this method, and it would be especially productive if a â€Å"richer† school district paired up with one that did not have the same luxuries. â€Å"Meet Mr. Shannon†, by Kristin Kearns Jordan, gives a viewpoint from a school in New York that struggles to add visual learning methods to their curriculum. The person in the title, Mr. Frederick Shannon, is considered a â€Å"master teacher† with his own manner of instruction called the â€Å"Shannon Plan† (Jordan, 2003, para. 2). He has used this method of primarily visual learning for twenty-five years, and he helps new teachers put it into place (Jordan, 2003, para. 2). For example, one teacher has picked up the habit of having a student dress as a â€Å"hamburger† to illustrate how a paragraph should be written. The â€Å"bun† simulates a strong opening and closing sentence, and the â€Å"meat† simulates the important information that should be given within the paragraph. She also uses â€Å"hand signals† to teach the components of a plot (Jordan, 2003, para. 4). Unfortunately, this school is plagued by regulations that cause the teachers to have to take classes on theory, which makes them not have time for special learning techniques (Jordan, 2003, para. 56). In this school, visual learning has to fall by the wayside. Considering that children now have to pass competency tests to move to the next grade, and seniors have to pass a graduation exam to receive a diploma, there is often little chance for teachers to vary from the standard program in their classes. It is little wonder that children with no chance for variation from the basic lessons tend to dislike school All three of these articles contain teachers who are ready and willing to use visual learning techniques, but some are much more lucky than others. Consider the South Carolina schools that have an expensive, state of the art visual program, and then think of the New York schools that are so bound in regulation that they can barely manage to fit a few skits in their lessons. Most schools will fall in the middle ground of using art and pictures as visual aides. In every case, though, visual elements enhanced the learning process, which should prove to even the most doubtful person that taking time for special types of learning enhances the educational experience. Notes and readings are not the only way to learn, and our nation’s educational system needs to bear that fact in mind if we are going to produce top caliber graduates.

Characteristics of Stem Cells :: essays research papers

Stem cells have two important characteristics that distinguish them from other types of cells. First, they are unspecialized cells that renew themselves for long periods through cell division. The second is that under certain physiologic or experimental conditions, they can be induced to become cells with special functions such as the beating cells of the heart muscle or the insulin-producing cells of the pancreas. Scientists primarily work with two kinds of stem cells from animals and humans: embryonic stem cells and adult stem cells, which have different functions and characteristics that will be explained in this document. Scientists discovered ways to obtain or derive stem cells from early mouse embryos more than 20 years ago. Many years of detailed study of the biology of mouse stem cells led to the discovery, in 1998, of how to isolate stem cells from human embryos and grow the cells in the laboratory. These are called human embryonic stem cells. The embryos used in these studies were created for infertility purposes through in vitro fertilization procedures and when they were no longer needed for that purpose, they were donated for research with the informed consent of the donor. Stem cells are important for living organisms for many reasons. In the 3- to 5-day-old embryo, called a blastocyst, stem cells in developing tissues give rise to the multiple specialized cell types that make up the heart, lung, skin, and other tissues. In some adult tissues, such as bone marrow, muscle, and brain, discrete populations of adult stem cells generate replacements for cells that are lost through normal wear and tear, injury, or disease. It has been hypothesized by scientists that stem cells may, at some point in the future, become the basis for treating diseases such as Parkinson's disease, diabetes, and heart disease. Scientists want to study stem cells in the laboratory so they can learn about their essential properties and what makes them different from specialized cell types. As scientists learn more about stem cells, it may become possible to use the cells not just in cell-based therapies, but also for screening new drugs and toxins and understanding birth defects.