Chikungunya virus Essays

Chikungunya virus Essays Chikungunya virus Essay Chikungunya virus Essay Abstraction The revival of Chikungunya virus ( CHIKV ) in several parts of Thailand runing from southern, northeast and North of Thailand with reported instances about 30,000 instances, get downing in October 2008 and ongoing until now ( November 2009 ) , has pointed out the public wellness concern. The chief clinical characteristics are onset of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia. The four about complete genome, representatives of 2008 and 2009, have been determined. Our survey shows that the closest related to the isolate in this eruption were the isolates from Kerela, South India of 2008 ( RGCB80, Accession No. GQ428212 ) demoing two coding part permutations: nsP2-L539S and E2-K252Q and the strain which predominant is ECSA strain, in contrast of the all old eruptions in Thailand which were Asiatic strain. Introduction Chikungunya Virus ( CHIKV ) is an enveloped, positive individual strand RNA virus with a genome of ? 11.8 kilobit [ 1 ] and belonged to the household Togaviridae and genus Alphavirus presently dwelling of 29 accepted members [ 2 ] . There is a 7-methylguanosine capped at the 5 terminal but a polyadenylated at the 3 terminal. The 5 two-thirds of the genomic RNA are responsible for the non-structural proteins. While the 3 tierce of the genomic RNA serves as the messenger RNA for the synthesis of the viral structural proteins [ 3, 4 ] . Harmonizing to the genomic organisation of other alphaviruses, the CHIK genome is acknowledged to be: 5 cap-nsP1-nsP2-nsP3-nsP4- ( junction part ) -C-E3-E2-6K-E1-poly ( A ) 3 . Alphaviruss have conserved sequences at the 5 and 3 terminals every bit good as the intergenic part. Among alphaviruses, conserved repeated sequence elements ( RSEs ) are besides observed in the 3 nontranslated part ( NTR ) . These conserved spheres play an of import func tion in the ordinance of viral RNA synthesis [ 5- 8 ] . CHIKV causes Chikungunya febrility ( CHIKF ) and chief clinical features include sudden oncoming of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia, which mostly affect the carpus, articulatio genus, mortise joint and little articulations [ 9 ] . The febrility about invariably precedes the roseola and joint hurting and has infrequently been reported as biphasic with return noted on the 4th or 5th twenty-four hours of unwellness [ 10, 11 ] . No studies of biphasic febrility were described during the 2005–2007 eruptions. In past eruptions, instances of feverish paroxysms in immature kids were besides reported [ 12 ] . Maculopapular and erythematous in character of the non-pruritic roseola is typically found and it will be seeable after infection for 2-5 yearss and may last up to 10 yearss. This roseola is distributed chiefly on the face, limbs and bole of the organic structure. Possibly the most important symptom of CHIKV infection is the te rrible articulation hurting that occurs with virtually every clinical instance [ 13, 14 ] . The patients who often reported disabling hurting that lasts for hebdomads or months have shown the articulations exhibiting enormous tenderness and swelling. Most infections wholly resolve within hebdomads or months but there have been documented instances of CHIKV-induced arthralgia prevailing for several old ages with up to 12 % of patients with CHIKV disease developing chronic articulation jobs [ 15- 17 ] . CHIKV was foremost described from the serum of a fevered homo during an eruption in Tanganyika ( now Tanzania ) in 1952–1953 during an epidemic of dengue-like unwellness [ 10 ] . Serologic and antigenic word picture of the isolates suggested that it was an alphavirus closely associated to Mayaro and SFV, while the initial appraisal was that the eruption was because of a dandy fever virus [ 18, 19 ] . Retrospective instance reappraisals have proposed that CHIKV epidemics occurred every bit early as 1779 but were often described inaccurately as dandy fever outbreaks [ 20 ] . During the sixtiess and 1990s, the virus was determined repeatedly from several states in Central and Southern Africa including Sudan, Uganda, Democratic Republic of Congo ( DRC, officially Zaire ) , the Cardinal African Republic ( CAR ) , Malawi, Zimbabwe, Kenya and South Africa. CHIKV has besides been isolated in western African states including Senegal, Benin, the Republic of Guinea, Cote dIvoire and Nige ria [ 21 ] . The virus is believed to hold originated in Africa and later was introduced into many parts of Asia [ 20 ] . Phylogenetic analysis of the CHIKV genome based on partial E1 sequences has identified 3 line of descents ; West African, Asian and East, Central and South African ( ECSA ) lineages [ 22 ] . In Africa, the virus is maintained through a sylvatic transmittal rhythm between wild Primatess and mosquitoes such as Aedes luteocephalus, Aedes furcifer, or Aedes taylori [ 23 ] while in Asia has been an urban transmittal rhythm, typically found in dengue-endemic countries and transmitted from human to human mostly by Aedes aegypti and, to a lesser extent, by Aedes albopictus [ 24 ] . The first CHIKV isolation in Asia was in Thailand in 1958 [ 25 ] and so other eruptions have been documented including Cambodia, Vietnam, Laos, Myanmar, Malaysia, Philippines, and Indonesia [ 23 ] Beginning in 1986, CHIKV outbreaks resurged with major disease bunchs documented in Senegal in 1986 and 1996/1997 [ 24 ] , Ivory Coast in 1996/1997 [ 26 ] , DRC during 1998–2000 [ 27 ] , Indonesia in 2003 [ 28 ] . Outbreaks occurred about continuously during 2004–2007 with 100s of 1000s of reported instances and new geographical countries involved [ 21 ] such as Kenya in 2004, Comoros in 2005 [ 29 ] , several Indian Ocean islands, in 2005, and India, in 2006-2007, which was an eruption of unprecedented magnitude [ 30 ] . Cases were besides reported in Europe ( UK, Belgium, Germany, Czech Republic, Norway, Italy, Spain and France ) , Hong Kong, Canada, Taiwan, Sri Lanka and the USA ; these were straight associated with the return of tourers from India and affected islands of the Indian Ocean [ 31 ] . The prevailing Aedes species in Madagascar and Reunion islands during 2005–2006 and in India in 2006/2007 was Aedes Albopictus [ 32 ] . The spread of chikungunya into rural countries during the ulterior phases of eruptions in India farther confirmed the potency of Aedes albopictus mosquitoes in conveying CHIKV [ 33 ] . These alterations were coincident with the outgrowth of a strain holding an alanine to valine permutation at codon 226 ( A226V ) of the envelope 1 ( E1 ) cistron in Reunion Island [ 34 ] and India [ 35 ] . This mutant is known to increase the transmissibi lity of the virus by Aedes albopictus [ 36 ] . This incident has been documented with the equid avirulent, Venezuelan equine phrenitis subtype ID viruses, where every bit small as 7 amino acid alterations can make epidemic forms of the virus responsible for immense eruptions [ 37 ] . The late September to October 2008, CHIKF eruptions have arisen in many southern states of Thailand particularly in Narathiwat, the southernmost state. There are plentifulness of Aedes Albopictus, the vector for CHIKV, in the plantation country, the common country of southern Thailand, and CHIKV was isolated from Aedes Albopictus in this outbreak country every bit good [ 38 ] . The suspension of CHIKF may be due to failure to observe low degree, continued transmittal in worlds, peculiarly because the symptoms may be mistaken for dandy fever febrility plus there is no accredited vaccinum or specific drug therapy available to bring around the unwellness, intercession relies upon vector control and minimising mosquito-human contact. Although there are several complete genomes of CHIK available in GenBank, the complete nucleotide sequence of CHIK distributing in Thailand is non available. In this survey, we conducted the about complete nucleotide sequence of virus isolated from four serum in 2008 and 2009, from Narathiwat state, the southernmost of Thailand and Bangkok where forbearance returned back from Nakhonsrithammaraj, the South of Thailand, inside informations were provided in table 1. In add-on, the phyletic beginning and the diverseness of the CHIKV strains responsible for reemergence in Thailand are besides considered. Method RNA extraction and RT-PCR CHIKV have been isolated straight from the patient s sera or from cell civilization which came from Vero cell at the first transition and the inside informations of sample were provided in table 1. Viral RNA were extracted by Viral Nucleic Acid Extraction Kit ( RBC Bioscience, Taiwan ) harmonizing to maker s process followed by contrary written text polymerase concatenation reaction ( RT-PCR ) utilizing Superscript III Pt One-Step Quantitative RT-PCR System ( Invitrogen, Carlsbad, CA, USA ) . A reaction mixture consisted of 2 ?l of extracted RNA, 5 ?l of 2x reaction mixed, 0.1 ?l of superior contrary RNA polymerase III Pt Taq polymerase, 0.5 ?M of each primer, and 6 ?l with nuclease-free H2O. The RT measure and PCR elaboration were performed in a Eppendorf Mastercycler personal ( Eppendorf, Hamburg, Germany ) at one time under the undermentioned conditions: contrary written text at 50 C for 30 min ; later initial denaturation at 95 C for 3 min ; followed by 40 rhythm of denaturation at 95 C for 1 min, primer tempering at 55 C for 1 min, and extension at 72 C for 1.30 min ; and concluding extension at 72 C for 7 min. All primers were used as show in table 2 which was designed towards S27 strains ( GenBank accession no. AF369024 ) [ 35 ] . Then the amplified PCR merchandises were analyzed by cataphoresis with 2 % -agarose gel in TBE buffer and stained by ethedium bromind, the expected set for the merchandise were visualized under UV visible radiation, excised from the gel and purified with the QIAquick Gel Extraction kit ( RBC Bioscience, Taiwan ) following the maker s instructions. The purified PCR merchandises were so used for direct sequencing by First BASE Laboratories SDN BHD ( Selangor Darul Ehsan, Malaysia ) . Table 1 Sample inside informations used in this survey sample codification day of the month of aggregation topographic point GenBank Acc No sample type CU-Chik661 2009 Narathiwat biological sample CU-Ckik009* 2009 Capital of thailand biological sample CU-Ckik10 2008 Narathiwat biological sample CU-Chik683 2009 Narathiwat virus isolate *patient returned from Nakhonsrithammaraj, the state in the South of Thailand. Table 2 Primers used for whole genome sequencing fragment cistron primer ( a ) Sequence ( 5 to 3 ) 1 5NC 18F CACGTAGCCTACCAGTTTCTTA nsP1 871R ATGGAACACCGATGGTAGGTG 2 nsP1 616F AACCCCGTTCATGTACAATGC nsP1 1435R CGGTACCACAAAGCTGTCAAAC 3 nsP1 1317F CACTGACCTGCTGCTGTCTATG nsP2 2130R AGTCCTGCAGCTTCTTCCTTC 4 nsP1 1412F CGAGTTTGACAGCTTTGTGGTA nsP2 2227R ATGACTGCAATTTTGTATGGGC 5 nsP2 1908F CAATCTCGCCTGAAGACTTCC nsP2 2709R TCCACTACAATCGGCTTGTTG 6 nsP2 2530F GTGCGGCTTCTTCAATATGATG nsP2 3343R TCCAGGCCTATTATCCCAGTG 7 nsP2 2577F AACATCTGCACCCAAGTGTACC nsP2 3504R GTCTCCTGTTGGCCGGTATAAT 8 nsP2 3332F TAATAGGCCTGGAGGGAAGATG nsP3 4134R CTACGCACTCTTCATCGTTCTT 9 nsP2 3885F GAACGAGTCATCTGCGTATTGG nsP3 4725R ATATCTCTGCCATATCCACTGC 10 nsP3 4458F TCTTTACAGCCATGGACTCGAC nsP4 5874R TCTACTTTGCGCGACTGATACC 11 nsP4 5630F CCCAGTATTCTTGGTTGCATG nsP4 6380R AAAACAGCACGCTTACCACG 12 nsP4 6184F AAAACAGCACGCTTACCACG nsP4 6936R AACTTGAAGCGCGTACCTGTC 13 nsP4 6732F TCATAGCCGCACACTTTAAGC nsP4 7495R AGGACCGCCGTACAAAGTTAC 14 nSP4 7278F GCAGGTGACGAACAAGATGAG C 8034R CCGCTTAAAGGCCAATTTG 15 C 7910F TCGAAGTCAAGCACGAAGG E2 8670R GTCTGTCGCTTCATTTCTGATG 16 E3 8459F TGCTTGAGGACAACGTCATGAG E2 9240R TTTGTGATTGGTGACCGCG 17 E2 9093F AGTCCGGCAACGTAAAGATCAC 6K 9861R AAAGGTTGCTGCTCGTTCCAC 18 E2 9648F AGTTGTGTCAGTGGCCTCGTTC E1 10403R TAAAGGACGCGGAGCTTAGCTG 19 E1 10145F ACAAAACCGTCATCCCGTCTC E1 11158R TGACTATGTGGTCCTTCGGAGG 20 E1 10959F CAGCAAGAAAGGCAAGTGTGC 3NC 11802R CTCCTACGTCCCTGTGGG The primers for the fragment 1-19 and the forward primer for fragment 20 are used from the published primers [ 36 ] and the contrary primer for fragment 20 was designed in this survey. Assembly of Genome Sequences and Sequence Analysis The genome sequences were analyzed utilizing the BLAST plan available in GenBank ( hypertext transfer protocol: //blast.ncbi.nlm.nih.gov/Blast.cgi ) . Then they were edited and assembled by utilizing CHROMASLITE ( v.2.0 ) and SeqMan ( DNASTAR, Madison, Wis. , USA ) . All sequences were aligned by utilizing Clustal X version 1.83 and phyletic trees were constructed utilizing the neighbor-joining method and Kimura s two-parameter with 1,000 bootstrapping method implemented in MEGA3.1 plan. Consequence Complete genome analysis of CHIKV in Thailand We determined the about full-genome sequences of four CHIKV isolates which were representatives of 2008 and 2009 in Thailand and the inside informations are provided in table1. The lengths of genome sequence of four isolates presented in this paper were 11,811 base brace except isolate CU-ChiK661 was 11,738 base brace. Every isolates shared the same length of big two ORF ; non-structural part 7422 bases ( 2,474 aa ) and structural part 3744 bases ( 1248 aa ) and besides shared 65-nucleotide junction between these two open reading frame excepting stop codon of the non-structural of unfastened reading frame and get down codon of the structural unfastened reading frame. The 5UTR ended at nucleotide place 62 for CU-ChiK661 and 76 for others. The 3UTR part started at nucleotide place 11,299 for CU-ChiK661 and 11,314 for others. Then they were aligned with complete 23 genome sequences available in GenBank. Overall, genome constructions of these four isolates were consistent with old work [ 41 ] . The isolates in this survey were found really closely related demoing 99.79-99.89 % individuality with one another and had an mean whole genome nucleotide individuality of 97.0 % with the S27 paradigm. The isolate which were near related with our isolates was the isolate from Kerala, South India: RGCB80, Accession No.GQ428212 demoing an mean 99.72 % individuality. The most closely related to S27 paradigm CU-Chik661 was the closest one to S27 strain. In the non-structural part showed 34 aa alteration ( 1.37 % ) lined in nsP1 nine aa alteration ( 1.68 % ) , nsP2 6 aa alteration ( 0.75 % ) , nsp3 11 aa alteration ( 2.07 % ) , and nsP4 7 aa alteration ( 1.14 % ) . The nsP3 showed the highest ratio alteration while the nsP2 showed the lowest ratio alteration which correlated with old survey [ 36 ] . When it comes to structural part, ChiK661 exhibited 25 aa alteration ( 2.00 % ) arranged in C 3 aa alteration ( 1.15 % ) , E3 1 aa alteration ( 1.56 % ) , E2 15 aa alteration ( 3.55 % ) , 6K 2 aa alteration ( 3.27 % ) , and E1 4 aa alteration ( 0.91 % ) ( table3 ) . Table 3 Comparison of amino acerb permutations identified in Thailand with that of S27 and other Indian isolates in 2007 and 2008 Region polypeptide place pritein place S27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsp1 29 29 Phosphorus . . . . Second . 105 105 Gram . Roentgen . . . . 128 128 Thymine K K K K K K 172 172 Liter Volt Volt Volt Volt Volt Volt 186 186 Nitrogen . . . . Calciferol . 234 234 Tocopherol K K K K K K 256 256 Tungsten . Roentgen . . . . 376 376 Thymine Meter Meter Meter Meter Meter Meter 383 383 Meter Liter Liter Liter Liter Liter Liter 384 384 I Liter Liter Liter Liter Liter Liter 481 481 Thymine I I I I I I 488 488 Q Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 507 507 Liter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 531 531 Calciferol Gram . . . . . nsp2 583 48 Volt A . . . . . 589 54 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 614 79 Phosphorus . . . . Second . 716 181 Volt A . . . . . 864 329 K Tocopherol . . . . . 909 374 Hydrogen Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1074 539 Liter Second Second Second Second Second Second 1117 582 C Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1118 583 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1328 793 A Volt Volt Volt Volt Volt Volt nsP3 1428 95 K Q . . . . . 1508 175 Volt I I I I I I 1534 201 Second . Gram . . . . 1550 217 Yttrium Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen 1659 326 Phosphorus Second Second Second Second Second Second 1664 331 Volt A A A A A A 1670 337 Thymine I I I I I I 1671 338 Thymine . . . . Meter . 1685 352 K Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1709 376 I Thymine Thymine Thymine Thymine Thymine Thymine 1715 382 A Thymine Thymine Thymine Thymine Thymine Thymine 1794 461 Liter Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus 1795 462 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1804 471 Phosphorus Second Second Second Second Second Second nsP4 1938 75 Thymine A A A A A A 1945 82 Roentgen . . . . Roentgen . 1950 87 Yttrium . . Hydrogen . . . 2117 254 Thymine A A A A A A 2157 294 Volt A . . . . . 2363 500 Q Liter Liter Liter Liter Liter Liter Region polypeptide place pritein place s27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsP4 2377 514 I Thymine Thymine Thymine Thymine Thymine Thymine 2418 555 Volt I I I I I I 2458 595 Nitrogen . . . . K . 2463 600 Roentgen . . . . I . 2467 604 Volt I I I I I I 2468 605 Thymine . . . . Second . 2469 606 Liter . . . . Meter . mirid bug 23 23 Phosphorus Second Second Second Second Second Second 27 27 Volt I . I I I I 28 28 Roentgen . Thymine . . . . 63 63 K Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen E3 284 24 I Thymine Thymine Thymine Thymine Thymine Thymine 290 30 K . . . Roentgen . . E2 382 57 Gram K K K K K K 399 74 I Meter Meter Meter Meter Meter Meter 404 79 Gram Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 409 84 F . . . Liter . . 485 160 Nitrogen Thymine Thymine Thymine Thymine Thymine Thymine 489 164 A Thymine Thymine Thymine Thymine Thymine Thymine 506 181 Liter Meter Meter Meter Meter Meter Meter 519 194 Second Gram Gram Gram Gram Gram Gram 536 211 I Thymine Thymine Thymine Thymine Thymine Thymine 554 229 Volt . I . . . . 576 251 Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 577 252 K Q . Q Q Q Q 592 267 Meter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 624 299 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 632 307 Q . . . Roentgen . . 637 312 Thymine Meter Meter Meter Meter Meter Meter 669 344 A Thymine Thymine Thymine Thymine Thymine Thymine 675 350 Gram . Second . . . . 700 375 Second Thymine Thymine Thymine Thymine Thymine Thymine 711 386 Volt A A A A A A 6K 756 8 Volt I I I I I I 802 54 I Volt Volt Volt Volt Volt Volt 813 65 Volt . A . . . . E1 1035 226 A Volt Volt Volt Volt Volt Volt 1078 269 Meter Volt Volt Volt Volt Volt Volt 1093 284 Calciferol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1113 304 Phosphorus . Liter . . . . 1131 322 Volt A A A A A A 1242 433 C Roentgen . . . . . Non-structural part Compared to S27 and, the CU-Chik661, CU-Chik009, CU-Chik10 and CU-Chik683 isolates have shared 26 permutations in the non-structural part: nine in nsP1 ( T128K, L172V, E234K, T376M, M383L, I384L, T481I, Q488R, and L507R ) , five in nsP2 ( S54N, H374Y, C582Y, S582N, and A793V ) , eleven in nsP3 ( V175I, Y217H, P326S, V331A, T337I, K352E, I376T, A382T, L461P, S462N, and P471S ) and six in nsP4 ( T75A, T254A, Q500L, I514T, V555I, and V604I ) as shown in table3. Most of these alterations were besides found in other isolates from Indian Ocean and Reunion isolate in 2006 and 2007, isolates from Kerala, South India in 2006-2008 and other parts of the universe. Interestingly, there was opal stop codon ( UGA ) at nsP3 codon 524 in the present isolates while S27 and Ross were non. This opal halt codon was besides observed in related alphavirus and old reported CHIKV isolates every bit good [ 35 ] . It is believed to modulate the look of nsP4, the putative RNA polymerase, by read-through mechanism [ 2, 39 ] Additional particular alterations were besides observed in ChiK10 ( nsP1-P29S, nsP1-N186D, nsP2-P79S, nsP3-T338M, nsP4-N595K, nsP4-R600I, nsP4-T605S, and nsP4-L606M ) and ChiK661 ( nsP4-Y87H ) . There was besides alone nucleotide permutation to the CU isolate which was non-synonymous alteration A6811G lined in nsP4 part. Structural part When analysing the amino acerb alteration of the structural protein 24 place were found to be common for the four isolates: three in C ( P23S, V27I and K63R ) , one in E3 ( I24T ) , 15 in E2 ( G57K, I74M, G79E, N160T, A164T, L181M, S194G, I211T, K252Q, M267R, S299M, T312M, A344T, S375T, and V386A ) , two in 6K ( V8I and I54V ) and four in E1 ( A226V, M269V, D284E, and V322A ) The lone one isolate which had specific alteration was ChiK009 demoing three specific aa place alterations ( E3-K30R, E2-F84L and E2-Q307R ) At the nucleotide place 9138, there was a alone event to the CU isolate demoing the same base as S27 and Ross strain while the remainder of other sequences antecedently reported had changed from T to C. 5 and 3 NTRs The 5 NTR of all four isolates were found to portion similarity with one another uncovering the mutant at place 68 from G to T in comparing to S27 which were besides detected in all the recent isolates. Merely did CU-Chik10 hold a mutant at nucleotide place T64A. There was no interpolation or omission has been observed. Within the 3UTR, sequences in this survey revealed the omission of a stretch 14 bases of 19 bases at place 11,369-11,342 compared to S27 except CU-Chik661 showed merely one A omission. This 14-A losing events besides showed in 2006 Indian Ocean isolates [ 35 ] . Phylogenetic analyses Fig.A1 illustrated the phyletic tree base on full genome analysis. CU isolates ( CU-Chik009, CU-Chik10, CU-Chik683 and CU-Chik661 ) arranged closest to isolates from Kerala, South India. Furthermore, they were crusted together with isolates during 2006 reunion eruption and 2007-2008 Indian eruption and related isolates. We besides determine extra E1 partial genome to analyse phyletic beginning as it is of import in phyletic analysis and there is more available sequence of this part including Asiatic and West-African strain. The phyletic tree based on E1 partial genome displayed in fig.A2. It revealed that all isolates in this survey were grouped in ECSA phylogroup. This determination was non the same phylogroup doing the eruption in 1958 in Thailand which was assigned in Asiatic strain. Discussion The first CHIKV described in Thailand was in 1958 in Bangkok [ 25 ] which was subsequently confirmed to be an Asiatic strain. [ 22 ] After that there were still a cyclicity of outgrowth of CHIKV in Thailand demoing a spread of 2-18 old ages: Prachinburi ( 1976 ) , Surinn ( 1988 ) , Khon Khen ( 1991 ) , Loei and Prayao ( 1993 ) , and Nongkhai and Nakorn Sri Thammaraj ( 1995 ) . During those outgrowths, the CHIKV all happened to be Asiatic strain [ 22 ] . CHIKV is presently doing one of the big eruptions reported in the past 50 old ages as in October 2008, bunch of febrility, roseola and terrible arthralgia was detected in one small town at Laharn wellness centre in Narathiwat and so chikungunya was suspected and confirmed subsequently. CHIKV has been distributing to next state of Narathiwat and the close state including Songkhla, Pattani and Yala by detecting several thousand instances reported in each country. Not merely has CHIKV been administering in the nearby country of Narathiwa t but besides go arounding in the other parts of Thailand including sou-east, cardinal, north and E of Thailand demoing more than 30,000 septic instances. The chief factor of distributing across the country is believed to be importing by travellers. This magnitude of the epidemics has arisen concernment of the public wellness of Thailand. As CHIKF was non a notifiable disease in Thailand, therefore the Bureau of Epidemiology had included CHIKF is the latest notifiable disease and launched in November 2008 ( inactive surveillance countrywide ; all gov. infirmaries and some private ) [ 40 ] . This survey revealed the high degree of preservation of this RNA virus within a peculiar eruption that has been of considerable involvement during the patterned advance of 2008-2009 Thailand epidemics. As observed in old findings of samples collected during an on-its-own eruption, isolate sequences showed merely rare alterations stand foring expected degrees of familial impetus connected with an RNA genome. However, some given mutants were identified that may hold an association with samples collected from patients stand foring more terrible unwellness. Our survey represents the first analysis, to our cognition, of intra-outbreak of CHIKV in Thailand of the molecular degree. Our phyletic analyses placed on partial glycoprotein E1 sequences confirmed that CHIKV distributing in Thailand was caused by the same strain on Reunion, Seychelles, Mayotte, Madagascar, Mauritius, Indian Ocean, and India, and showed that this strain is related to East- , Central- and South-Africa isolates non th e Asiatic strain as old eruption in Thailand. In add-on, E1-226 was the lone genotype observed during this eruption. Previous surveies showed that the mutant of amino residue 226 of E1 genome of SFV was observed to let go of the cholesterin dependance of the virus [ 41, 42 ] which might convey an advantage to virus in mosquitoes which are cholesterin auxotrophs, therefore CHIKV might hold the favour from this mutational alteration every bit good. From all sequence of CHIKV except S27 and Ross strains have shown opal halt codon ( UGA ) at nsP3 codon 524. Restricting the figure of transitions is the key because the infecting viral population may maintain up a correspondence to a quasispecies [ 43, 44, 45 ] . Repeated in vitro transitions could move as a filter on this population. For case, the presence in S27 of an Arg codon alternatively of the opal halt codon in other isolates is possibly explained by legion in vitro transitions of S27, as development of opal to Arg was observed by experimentation in ONN viruses [ 46 ] There is no aminic acid alteration detected among this eruption that is unambiguously associated with the Central/East African genotype from which the strain doing the 2008-2009 epidemics evolved. However, there are two alterations, one at the nsP2-L539S and one in the E2-K252Q that about alone to these isolates irrespective of three isolates from Kerala, South India, either alteration alters the hydrophobicity and charge of the amino acid incorporated but the biological relevancy of these alterations can merely be speculated. Chik10 had revealed the most alterations compared to three isolates and Chik10 was the lone sample collected in 2008 and it had specific alterations that have nt shown in other isolates. Therefore those alterations might non remain circulate in this eruption or it was non the strain which predominate. Although CHIKV eruption has happened in Thailand since 2008, it is still ongoing circulate in several parts of Thailand so the farther probe should be considered.

Health and safety in the health and social care workplace Essay Example

Health and safety in the health and social care workplace Essay Example Health and safety in the health and social care workplace Essay Health and safety in the health and social care workplace Essay Health and safety in the wellness and societal attention workplace Contentss Introduction Task-2 2.1 How information from hazard appraisals informs care be aftering for persons and organisational determination doing about policies and processs 2.2 The impact of one facet of wellness and safety policy on wellness and societal attention pattern and its clients 2.3 Discuss how quandary encountered in relation to implementing systems and policies for wellness, safety and security may be addressed 2.4 The effects of non-compliance with wellness and safety statute law in a wellness and societal attention work topographic point Task-3 3.1 How wellness and safety policy and patterns are monitored and reviewed 3.2 The effectivity of wellness and safety policies and patterns in the workplace in advancing a positive wellness and safety civilization 3.3 My part to puting the wellness and safety demands of persons at the Centre of pattern Decision: Introduction Health and safety demands are the basic right of every human being. Therefore, wellness and societal attention organisation must guarantee wellness and safety demands to their clients every bit good as their employees working for them. Each organisation must hold information for pull offing the hazards which can do injury to their workers or the clients. To supply safety updates to their clients at first, hazard factor appraisal should be taken topographic point. By making hazard assessment the authorization can be able to cognize which hazards can harm their service users. With aid of the hazard assessment the authorization can take attention planning and appropriate determinations for their client’s safety. Therefore, it helps to present appropriate statute laws or policies. To supply the best safety steps, the authorization must be on a regular basis checked these policies. By supervising and reexamining the patterns, we can guarantee fewer accidents in the workplace. Effec tive wellness and safety policies can convey better repute of the organisation and additions trust from their clients. Task-2 2.1 How information from hazard appraisals informs care be aftering for persons and organisational determination doing about policies and processs ’Risk assessments’ inform appropriate ’care planning’ for the persons and affect changeless monitoring of alterations if it is needed. Harmonizing to the definition, attention planning is a record of demands, ends and intercessions, puting out actions for run intoing the person’s demands who uses the services sing their physical wellness, personal state of affairs, household relationships, and specifying how these demands affect their wellness. Actually attention programs involve the countries of the user’s physical wellness, mental wellness province, disablement, adjustment and employment, fundss, inside informations of kids or immature people ( under 18 ) life with the patient who uses our services or with whom the patient who uses our services has important contact, societal activities, spiritualty and ethnicity, gender, civilization, carers views about the fortunes of the individual they care for, carers assessment, where apposite. Hazard appraisals is one of the of import tools of determination devising, which promotes the promotion and usage of logical methods for bettering decision-making in wellness and societal attention workplaces. By executing these appraisals we can really cognize the jeopardies in the workplace and find the client’s demands and do appropriate determinations harmonizing the demands. 2.2 The impact of one facet of wellness and safety policy on wellness and societal attention pattern and its clients There are many characteristics of health and safety policy’ on wellness and societal attention pattern and its client such as workers safety consciousness, effectivity of review, authorities steps etc. Among them review has a outstanding influence on health and societal attention practice’ . Below we precis some research documents on the impact of review of health and safety policy on wellness and societal attention practice’ and its client from U.K, which have applied backsliding analysis to aggregate informations at industry degree. Bartel and Thomas ( 1985 ) ten included reviews, review punishments, and the lost workday hurt rate to project a coincident equation theoretical account. They collected industry-level informations for the period 1974 to 1978. Their informations showed that though greater frequence of reviews gave rise to increased wellness and safety conformity, but this had non important consequence on cut downing hurt rates. Viscusi ( 1986 ) xi analyzed hurt rates by sing different factors such as control of expected mulcts, industry, twelvemonth and non-health and safety variables that could hold resulted in alterations in the hurt rate. He used industry-level informations for the clip period 1973to 1983. He found important effects of wellness and safety reviews on hurt rates. Furthermore, he did non happen any grounds in favour of ground that increased punishments would do lower rate of hurts. Gray and Jones ( 1991 ) twelve showed that farther wellness reviews in bring forthing workss reduced the figure of disputes of worker exposure limitations. They besides found first wellness review as the strongest impact factor, and they besides matched all Occupational Safety and Health Administration ( OSHA ) wellness reviews for single fabrication workss which were inspected during the period of 1972 to 1983. 2.3 Discuss how quandary encountered in relation to implementing systems and policies for wellness, safety and security may be addressed In the workplace, de facto communicating of wellness and safety is normally faced with a wide scope of predicaments andproblems. However, to guarantee the full procedure effectual, assorted factors should be considered, including hazard to others, hazard to self, resource illations, risk-benefit analysis, and divergent precedences between stakeholders, either external or internal. Care be aftering ensures the sound execution of the safetypolicy through effective scheme, including execution of the rules of wellness and security and optimisation of the wellness of employees. To make a safe and healthy environment at different degrees such as single, squad, or organisational degrees, organisations should prevail on understanding, duties, preparation, performs, and how different groups, persons and bureaus merge to each other. Organization should supervise and assesses wellness and safety policies, and execution procedure via review and scrutinizing the workplace. Management has to do ce rtain that all employees are trained on wellness and safety issues, such as cleanliness which is indispensable in avoiding nutrient toxic condition, conforming of effectual process of disposing of waste etc. that may happen during working period. Like, banana Peel should non be thrown on the floor because it can do deadly accident to other employees. There are other critical issues that can significantly diminish the menaces. In this manner quandary can be addressed. 2.4 The effects of non-compliance with wellness and safety statute law in a wellness and societal attention work topographic point Non- conformity with wellness and safety or breach of Health and Safety Regulations’ is a act of misconduct and can be result as in the Company, Corporation, or an single director etc. , being accused by the pertinent Health and Safety Enforcement Authority’ and if the individual or organisation is found guilty he/she can be fined or imprisoned. The individual who is guilty ( every bit good as the organisation ) can be charged under section 37’ of the Health and Safety at Work Act 1974’ . Each breach whether it is intentionally go againsting the fundamental law or by being highly lax in making judicial responsibilities that result in lives in danger, can take to limitless mulcts and/or imprisonment. Health and safety enforcement governments can publish an promotion or interdiction notice to the workplace, apart from prosecuting the employer. Generally, an promotion notice by and large requires a improvement to be made in 21 yearss can be extended if needed. But in an exigency instance, it should be improved instantly. Non-compliance with a notice can bring forth prosecution in the magistrate’s courts’ . A worker injured at work or the client who is affected, fundamentally the victim can action the organisation or the guilty individual for amendss if the individual is inattentive in any manner in supplying safe and healthy provinces. Those found blameworthy are accountable for imprisonment and mulcts. In add-on, the Company Directors Disqualification Act 1986’ , subdivision 2 ( 1 ) ’ , certifies the tribunal to censor an single declared of an offense in association with the direction of the company. This power is implemented at the discretion of the tribunal and needs no extra grounds or probe, therefore ensures wellness and safety. The offense of any decease is chargeable by an limitless mulct and a maximal penalty of life imprisonment. Task-3 3.1 How wellness and safety policy and patterns are monitored and reviewed Prevention is ever better than remedy. Agreements for analyzing and appraising the wellness safety precautional steps can be introduced with the aid of hazard appraisals which should be antecedently done and do certain that the efficaciousness of these steps are maintained decently and the hazard is under controlled. Hazard appraisals should non be practiced one time for all, it should be monitored on a regular basis for the undermentioned reasons- many alterations occur in the work topographic point so new alterations should be monitored, if a new step has been introduced such as new equipment or stuffs so new working conditions should be applied in order to forestall any hazard by them. If it is non measured so accident will happen or near miss’ -an accident which antecedently didn’t occur but with the new alteration it happened will ensue in hurt or life hazards. The board can guarantee some nucleus actions as a monitoring- preparation and care programmes can be held and incident informations such as decease rates, inadvertent rates can be collected, periodic hazard Appraisals and fecundity of the preventative steps can be audit, influence of alterations such as new equipment debut or work procedures or critical wellness and safety failures should be presented in no clip and appropriate steps should be taken. 3.2 The effectivity of wellness and safety policies and patterns in the workplace in advancing a positive wellness and safety civilization Guaranting health and safety’ in the workplace should non be seen as an administrative liability: it offers some noteworthy chances or effectivity in the work topographic point. Benefits from the wellness and safety policies we can acquire the followerss: Reduced costs:If wellness and safety statute laws are antecedently taken by the organisation so we can certainly cut down some unwanted costs which can happen if any inadvertent incident happens. Reduced hazards:We can surely cut down hazards in the organisation by the hazard appraisals which is a portion of wellness and safety pattern. Unwanted hazards can be prevented by the hazard appraisal. Lower employee absence and turnover rates:If we can non guarantee safety to our employees who work for the organisation so they will be less sincere to the work topographic point and absence and turnover rates will be higher. Fewer accidents:If we can guarantee adequate safety in the workplace so we can certainly cut down the accidents. So it means we can hold fewer accidents compare to old if safety steps are improved and checked on a regular basis in a everyday mode. Lessened menace of legal action:By the decrease of fewer accidents or hazards in the work topographic point we can decrease our menace of legal action. It is known to everybody that legal punishments are truly high of the carelessness in the wellness attention workplace, so taking appropriate preventative steps we can avoid those punishments. Better repute among clients and communities:If we can guarantee a safe wellness attention Centre to our clients and workers so the repute of our organisation will be higher and we can derive the trusts of our clients and guarantee them maximal client satisfaction. 3.3 My part to puting the wellness and safety demands of persons at the Centre of pattern I act as an of import individual in my Centre of pattern in puting wellness and safety demands and my ain parts to puting safety of persons are given below- At first, I merely go through the hazard appraisals of my workplace and happen out where certain hazards can be occurred. Based on the hazard appraisals I analyze which sort of safety steps should be taken attention of. If new alteration is introduced to my workplace so doing an appropriate determination based on the alteration should be practiced and if any new bars is needed so I inform the senior authorization to take appropriate actions. I besides collect incidental records such as decease records, inadvertent records and do some appropriate bars to get the better of the accidents. Decision: Every wellness and societal attention organisation must guarantee appropriate wellness and safety steps to their service users every bit good as their employees. Health and safety demands is a basic demand of any individual so taking it lightly is a serious offense. Not merely wellness attention workplace should take it earnestly but besides other organisations should be able to guarantee their safety bars. For doing a safe workplace one should first take topographic point hazard appraisals to pull off the hazards and supply regular updates on relevant issues. If any workplace is failed to supply their clients plenty safety so they will hold to give punishment on their actions. It is known to everyone that safety issues can convey approximately highest punishments to the authorization such as mulcts and maximal imprisonment. Effective wellness and safety policies and patterns can do a positive wellness and safe civilization and brings fewer accidents, reduces costs and hazards, lesse ns legal punishments, diminishes the employee absence and turnover and creates better repute of the workplace among the service users and the society. Mention: Mason, Diana J, Judith K Leavitt, and Mary W Chaffee.Policy A ; Politicss In Nursing And Health Care. St. Louis, Mo. : Elsevier/Saunders, 2012 Collins, Suzan.Health And Safety. London: Jessica Kingsley, 2009 Barlett, Donald L, and James B Steele.Critical Condition. New York: Doubleday, 2004 Chemical bond, Richard G, George S Michaelsen, and Roger L DeRoos.Environmental Health And Safety In Health-Care Facilities. New York: Macmillan, 1973 Farley, Donna.Measuring Patient Safety Practices And Outcomes In The U.S. Health Care System. Santa M Fottler, Myron D, Naresh Khatri, and Grant T Savage. Strategic Human Resource Management In Health Care. Bingley, UK: Emerald, 2010. Print. onica, CA: RAND, 2009. Roth, Herbert H, Erwin S Teltscher, and Irwin M Kane.Electrical Safety In Health Care Facilities. New York: Academic Press, 197. OSHA In The Real World. Santa Monica, Calif. : Merritt Pub. , 1996 Hall, Mark A, and Sara Rosenbaum.The Health Care Safety Net In A Post-Reform Universe. New Brunswick, N.J. : Rutgers University Press, 2012 [ 1 ]

Cambrian Explosion Research Paper Example | Topics and Well Written Essays - 1500 words - 2

Cambrian Explosion - Research Paper Example Some of the animals with basic animal bodies include arthropods such as insects, crustaceans, and trio-bites, cnidarians like jellyfish and corals, mollusks such as shellfish and squids, echinoderms like sea urchins and sea star, and chordates such as vertebrates. The Cambrian exposition occurred during the Cambrian period that began 570 million years ago and ended 510 million years. According to Meyer et al. (2001), the Cambrian exposition occurred within a window of 20 to 40 million years during the Cambrian period. According to BBC, (2015), the Cambrian period began 545 million years ago and ended 495 million years ago. The Cambrian period was characterized by the sudden emergence of living organisms in the sea. Although geologists are lucky to identify some Cambrian fossils, there was no life on the land. According to Darwin’s theory, the Cambrian exposition is based on the existence of changing environmental conditions that cause genetic modification of genes. The major cause of the Cambrian exposition is believed to be a rapid increase in the oxygen level in the atmosphere. An increase in oxygen level in the atmosphere occurred approximately 2.3 or 3 million years when numerous microorganisms released oxygen to the atmosphere through photosynthesis. The second oxygen increase event occurred approximately one billion years ago and resulted in the development of various complex organisms during the Cambrian period. The link between the increase in oxygen levels and development of complex organisms is confirmed by various past events. For instance, the oxygen concentration is believed to have increased from 10 % to 21% in the past 425 million years. The event resulted in the evolution of vertebrates thus attaining essential features. Secondly, high oxygen concentration level in the atmosphere resulted in an increase in insect size (Koch & Britton, 2009). According to Penumaka (2011), the earth was covered by glacier 580 million years ago thus

Service Management Essay Example | Topics and Well Written Essays - 1250 words

Service Management - Essay Example The organizations that deal in banking, hospitality and consultancy amongst others are all included in the services sector (1). The importance of services in the industrialized economies has constantly been ignored. There are many services in that are not taken in to account, mainly in the agricultural and the industrial sector, which are not viewed as contributors of services to the economies. However, they contribute to the service sector in an unseen manner (2). Consumers are usually concerned with the amount of satisfaction derived from the services offered. It is important for service providers to understand that value is of utmost importance if they have to excel in the business of service marketing. The service perspective is important in the accomplishment of satisfaction amongst the consumers. This is an aspect of marketing whereby marketers ensure that a number of services are provided for the customers to make a choice. This is important for the business in order to ensure that it has a competitive advantage over other service providers, thereby increasing the sales volume. Service perspective involves the engagement of people who are capable of offering the most efficient services to customers in order for them to get motivated to come back for more. This is a significant tool for ensuring that customers build trust in the service provider. Apart from increasing the competitive advantage of the service provider, it helps in encouraging the customers to buy more and also encourage new customers to the business. The reputation of the business is improved, and customers do not complain in regard to the services offered to them. Adopting the service perspective is significant in reducing the cost of production, since acquiring new customers is usually difficult and costly. It therefore plays a significant role in maintaining

Use of Visual Aides in the Modern Classroom Essay Example for Free

Use of Visual Aides in the Modern Classroom Essay Visual aides have become important to the learning processes of children in all grades of school. From simple skits to enhanced computer calculations and comparisons, teachers everywhere are learning the power of having their students visualize and take part in what they are expected to learn. This process is a great departure from the classic learning model of reading along and taking notes, so it takes some teachers and faculty a while to accept and learn new styles of teaching. The three articles that I have chosen show the value of visual aides in the classroom, but also note the difficulties of changing long held educational beliefs. â€Å"You Gotta Have Art! †, by Roger Glass and Priscilla Nemeth, describes the impact of visual learning in classes around the United States. For example, in order to visualize â€Å"natural environments found in Florida†, students were prompted to paint a mural on a school wall showing what they had learned in their science class. The mural was a way to learn as well as a point of pride to the children who helped create it (Glass Nemeth, 2003, para. 5). Other schools use â€Å"a print of the city† to teach local history and geography, instead of simply using a plain map. The print allows children to see the buildings and sites that they discuss in class, rather than just have the areas pointed out to them on a basic city map that includes only streets and symbols (Glass Nemeth, 2003, para. 3). The results have been more than anyone could have expected. Attendance and discipline have improved in the schools that promote visuals in the classroom, and scores on standardized tests have risen dramatically (Glass and Nemeth, 2003, para. 2). It is apparent from this article that allowing children to see what is special about a subject, and also take part in projects that they can be proud of, encourages them to come to school interested and ready to learn. â€Å"Talking Science, Modeling Scientists†, by Elizabeth Edmondson, William H. Leonard, Chris Peters, and Anna O. Baldwin, describes a program in place in South Carolina schools that lets the students learn visually in class and then share the knowledge with students in other schools who are learning the same lesson. Students were taught a science unit on electric circuits by such means as â€Å"lighting a bulb with a battery, bulb, and wire, constructing a flashlight using a series or parallel circuit and switch, and designing and wiring a simple cardboard house† (Edmondson, et al. , 2006, p. 29). The learning did not stop there. Students learned to write about what they had visually learned, and then shared the information with student partners over a special system. (Edmondson, et al. , 2006, p. 30). This system allowed students from each school to post questions and answers to each other by means of a dedicated message board (Edmondson, et al, 2006, p. 30). Students were encouraged to â€Å"buddy up† and work on projects together (Edmondson, et al, 2006, p. 30). Also, those having trouble learning were paired with those who had a mastery of the subject, so long distance peer tutoring occurred as well (Edmondson, et al, 2006, pg. 31). Teachers reported that this system of visual and hands on learning much improved the students’ comprehension levels and incidently improved their writing skills due to the reports that they posted (Edmondson, et al. , 2006, p. 31-32). This project not only serves as an interest to children who easily catch on to the lesson, but it also gives them a chance to help fellow students who are struggling. Achievement is possible for all with this method, and it would be especially productive if a â€Å"richer† school district paired up with one that did not have the same luxuries. â€Å"Meet Mr. Shannon†, by Kristin Kearns Jordan, gives a viewpoint from a school in New York that struggles to add visual learning methods to their curriculum. The person in the title, Mr. Frederick Shannon, is considered a â€Å"master teacher† with his own manner of instruction called the â€Å"Shannon Plan† (Jordan, 2003, para. 2). He has used this method of primarily visual learning for twenty-five years, and he helps new teachers put it into place (Jordan, 2003, para. 2). For example, one teacher has picked up the habit of having a student dress as a â€Å"hamburger† to illustrate how a paragraph should be written. The â€Å"bun† simulates a strong opening and closing sentence, and the â€Å"meat† simulates the important information that should be given within the paragraph. She also uses â€Å"hand signals† to teach the components of a plot (Jordan, 2003, para. 4). Unfortunately, this school is plagued by regulations that cause the teachers to have to take classes on theory, which makes them not have time for special learning techniques (Jordan, 2003, para. 56). In this school, visual learning has to fall by the wayside. Considering that children now have to pass competency tests to move to the next grade, and seniors have to pass a graduation exam to receive a diploma, there is often little chance for teachers to vary from the standard program in their classes. It is little wonder that children with no chance for variation from the basic lessons tend to dislike school All three of these articles contain teachers who are ready and willing to use visual learning techniques, but some are much more lucky than others. Consider the South Carolina schools that have an expensive, state of the art visual program, and then think of the New York schools that are so bound in regulation that they can barely manage to fit a few skits in their lessons. Most schools will fall in the middle ground of using art and pictures as visual aides. In every case, though, visual elements enhanced the learning process, which should prove to even the most doubtful person that taking time for special types of learning enhances the educational experience. Notes and readings are not the only way to learn, and our nation’s educational system needs to bear that fact in mind if we are going to produce top caliber graduates.

Characteristics of Stem Cells :: essays research papers

Stem cells have two important characteristics that distinguish them from other types of cells. First, they are unspecialized cells that renew themselves for long periods through cell division. The second is that under certain physiologic or experimental conditions, they can be induced to become cells with special functions such as the beating cells of the heart muscle or the insulin-producing cells of the pancreas. Scientists primarily work with two kinds of stem cells from animals and humans: embryonic stem cells and adult stem cells, which have different functions and characteristics that will be explained in this document. Scientists discovered ways to obtain or derive stem cells from early mouse embryos more than 20 years ago. Many years of detailed study of the biology of mouse stem cells led to the discovery, in 1998, of how to isolate stem cells from human embryos and grow the cells in the laboratory. These are called human embryonic stem cells. The embryos used in these studies were created for infertility purposes through in vitro fertilization procedures and when they were no longer needed for that purpose, they were donated for research with the informed consent of the donor. Stem cells are important for living organisms for many reasons. In the 3- to 5-day-old embryo, called a blastocyst, stem cells in developing tissues give rise to the multiple specialized cell types that make up the heart, lung, skin, and other tissues. In some adult tissues, such as bone marrow, muscle, and brain, discrete populations of adult stem cells generate replacements for cells that are lost through normal wear and tear, injury, or disease. It has been hypothesized by scientists that stem cells may, at some point in the future, become the basis for treating diseases such as Parkinson's disease, diabetes, and heart disease. Scientists want to study stem cells in the laboratory so they can learn about their essential properties and what makes them different from specialized cell types. As scientists learn more about stem cells, it may become possible to use the cells not just in cell-based therapies, but also for screening new drugs and toxins and understanding birth defects.

Parthenon and Lincoln Memorial Essay

I have chosen the above two architectural marvels for this essay. While Parthenon belongs to the ancient times , around 32 B. B. its architects were Iktinos and Kallikratesand. ( Parthenon). It was a place of worship, for the Athenians, the Lincoln memorial was constructed much later, in the 20th century, and was constructed in the fond memory of the 16th president of the United states of America, Abraham Lincoln. Before analyzing these marvelous works of art, it is necessary that one is thorough in the concept of an organizational system, known as ‘Doric order’, formulated by the ancient Greeks, in their style of architecture. Both these structures are based on this concept. In the Doric order, a style of architecture, first followed by the ancient Greeks, the column does not have a base. The shaft is either based on a square or a circle. The top end of the shaft, known as the ‘capital’, rests under the ‘architrave’. It is important to note that the Greeks had widely used this style, in horizontal alignment, to achieve an impressive visual appeal. ( Mell Devin, Doric style ) Sketch illustrating the Doric column ( Mell Devin ) Originally this building was conceived as a temple of Goddess Athena. The floor plan of the Parthenon adheres to the ratio of 9: 4 and similarly the number of columns also adhere to the same ratio. There are 17 columns along the length and 8 along the width. The floor plan of Parthenon ( The Parthenon, page 1) A horizontal row of 6 Doric columns support the front and the back porch, and the interior space was divided in two unequal rooms. The larger one was devoted to the placement of the statue of Goddess Athena and was surrounded by 23 Doric columns over a two storied structure. The back portion was the treasury of the kingdom. The visual elements of this structure are so designed that the visitor to Parthenon experiences a smooth transition from the visual characteristics of the exteriors to those of the interiors. The visitor also experiences another smooth transition from earthly to divine, when he watches the Panathenaic procession on the Frieze. The statue of Athena, has mesmerizing hues of Gold and ivory, framed shorter Doric columns, in double decked arrangement. This makes the inner space appear larger and taller than the exterior pace. The planning reveals as if it has been designed as a theatrical event, where after experiencing the grandeur of the structural views and the procession on Frieze, the visitor gets to view the statue of Goddess Athena. ( The Parthenon, page 1) This masterpiece one great quality of the Athenian sense of visual elements. It is a proof of the fact that they had mastered the art of the relationship between form and space. The horizontal placement of the Doric columns on the outer edge of the rectangle and the same columns epeated in the inner hall, in a smaller scale, are solid evidences of their understanding of spatial relationships. During so many centuries of its existence, Parthenon has witnessed many attacks and change of functions also. From A Athenian temple, it was turned into a church, and later a mosque also. The structure was partially destroyed as a result of explosion, and today, only the relics of Doric columns can be seen. ( wikipedia) The other marvelous piece taken for analysis in this essay, is the Lincoln Memorial, at Washington D.  C. , USA. This structure is modeled and inspired by the Doric style of columns. The floor of this monument is also a rectangle, and has 36 such columns along its periphery.. This number represents the number states which had acceded to the federal structure of USA, at the time of assassination of Lincoln. Lincoln memorial sketch, clearly revealing the impact of Doric columns on the visual appeal of the monument. (The Lincoln memorial) This monument was built in the fond memory of Abraham Lincoln, the 16th president of USA. It was opened for public in 1922, and was designed by architect, Henry Bacon. ( Lincoln memorial) The composition of form and space and the visual metaphor in this case resembles to that of the Parthenon. As a matter of fact, the visual splendor is enhanced by the graceful, stunning and visually arresting beauty of the white marble. As a visual form, the flatness of the structure above the Doric columns lend s a very pleasing visual appeal. One important aspect of the Lincoln memorial is that it represents the Parthenon, thematically also. The statue of Lincoln represents that of goddess Athena and the procession is represented by historical speeches of Lincoln, namely his second inaugural speech and the Gettysburg address. ( Lincoln memorial). Talking of the elements of design, the striking contrast between the Parthenon and the Lincoln memorial is that the later, perhaps under the effect of modernism and the after effects of renaissance era, has very flat horizontal and vertical lines domination the canvas of vision. This lends a far more pleasing perspective view from a distance, than he Parthenon, which has inclined lines intercepting the vertical composition formed by the Doric columns. Moreover, the decorative elements, like motifs and patterns which are so evident in the Parthenon, are not seen in the Lincoln memorial This is suggestive of the impact minimal movement has had on the designers. Conclusively, it can be said that, despite having a time gap of thousands of years between their evolution, the Parthenon and the Lincoln memorial are adhering to similar design principles, the same style of visual expression, and similar perceptions of visual composition.

MW corporation

Structure and execute a DCF valuation of all the MW reserves using APV. How much are the reserves worth? Is your estimate more likely to be biased high or low? What are the sources of bias? Answer: The DCF valuation of all the MW reserves using APV Indicates that the net worth of the portfolio is around $516. 30 million. The estimate Is more likely to be biased on the higher side. The data for the projections was collected by Morgan Stanley and Amoco. Thus, the probable undeveloped and possible reserves estimated may be different from the ctual reserves.Amoco can get higher valuation by projecting higher reserves. Also, Amoco and Morgan Stanley projected that the price of a oil barrel will continue to rise for the next 15 years from the current price of S 20. 4 per barrel to S 443 per barrel. This increasing value of per barrel can significantly increase the valuation of the oil fields. COSTS: The costs In the projections were estimated based on the historical costs and cash overhead savings that Amoco expected to save from the sale of MW petroleum. However, Apache had very low costs and was an efficient operator of properties.Also, since the MW fields were operated by Amoco; this would result In more potential savings to Apache. likely to biased on the higher side. The DCF valuation using APV is shown in the next page. Interest tax shields: Assumed coupon on debt 12. 32% Assumed initial debt 182. 7 Year 1 interest 22. 5 Tax rate 36% Year 1 tax shield 8. 1 Assumed cost of debt 12. 00% Growth rate -4. 06% Value of tax shield (perpetuity) 50. 4 Value of â€Å"Additional assets† 25. 0 Total value of MW 516. 3 2. How would you structure an analysis of MW as a portfolio of assets-in-place and options?Specifically, which parts of the business should be regarded as assets-in- place and which as options? The whole portfolio of MW consists of 5 parts: i. Proved developed reserves it. Proved undeveloped reserves iii. Probable reserves ‘v. Possible reserves v . Other opportunities options as capital expenditures are associated with proved undeveloped reserves, probable reserves and possible reserves, and the company can choose whether to make these expenditures basing on the then prevailing prices of oil and natural gas.

Nurses of World War 1 essays

Nurses of World War 1 essays Before World War I, the stereotype of a woman was a delicate mother or a housewife. The war was an opportunity for all women, including nurses, to break that stereotype and be involved with public, national affairs. Poster campaigns created posters picturing glamorous, All-American girls to attract women to join the war effort as nurses and doctors. Women started being encouraged to be tough, and the whole idea of being feminine changed; however, female nurses still had to struggle to change the attitudes of those who did not like women taking an active role in some part of the military. Even though nursing had always played an important part in wars before WWI, it had never before been considered a part of the military. The role played by nurses in the war was difficult as well as physically and emotionally draining. Their living conditions were far from perfect, and they had to clean wounds, perform minor surgeries, and give treatments with minimal supplies. The work was long and tiring, yet the nurses were still expected to be sprightly mother figures to each and every patient. The health, as well as the lives, of the nurses was also at risk. If a septic wound were to get into the smallest of cuts, the nurse could have come down with numerous types of sicknesses or diseases considering that their immune systems were terribly weak from eating low standard food at irregular times and not getting very much sleep. More than 23,000 women served as nurses from different organizations involved in the war including the Army nurses, Navy nurses, volunteer nurses, and American Red Cross nurses. Sometimes, hostility arose between the professional nurses and the volunteer nurses. They both did the same work in caring for the patients; however, they had different views on how the job should be done. The professional nurses were preoccupied with healing the soldiers strictly by the book, unlike the volunteers ...

Unlike No Other

Unlike No Other Unlike No Other Unlike No Other By Maeve Maddox I heard a radio announcer say that something was â€Å"unlike no other.† I could tell from the context that he meant the thing he was talking about was unique. As I usually do when I read or hear nonstandard usage in a professional context, I jumped on my search engine to see if anyone else was using it. What I found suggests that many speakers use â€Å"unlike no other† as if it did mean â€Å"one of a kind.† Relationship problem unlike no other? (about a boy who feels his romantic situation is unique) Urban Novel Unlike no Other (reviewer recommending a novel) Trees unlike no other (description of unusual trees) A community unlike no other! (a group of gamers) A show unlike no other (ad for an entertainment program) The expression â€Å"unlike no other† doesn’t mean â€Å"one of a kind.† On the contrary, it means â€Å"like all others.† The prefix un: â€Å"I am not unhappy.† is equivalent to â€Å"I am happy.† Note: A discussion of the two negatives equal a positive rule in English calls for a post of its own. This one focuses on why the expression unlike no other should be avoided. Like means â€Å"having the same characteristics as something else.† Adding the prefix un- to like creates an adjective that means â€Å"dissimilar.† Technically, to say that something is â€Å"unlike no other,† is to say that it is like everything else. To express the thought that something is â€Å"unique† or â€Å"one of a kind,† drop the un- and say that the thing is â€Å"like no other.† For example, Grab a cup of cider and head to Red Arrow Park in beautiful Milwaukee, Wisconsin for a fun, low-key New Years Eve like no other. A Race Like No Other: 26.2 Miles Through the Streets of New York (book title) Another way to express the thought is to use the phrase â€Å"not like any other.† They proof their dough for 24 hours which allows it to rise and ferment to a flavor not like any other bread available in Brooklyn This is truly a movie not like any other. Apparently the wording â€Å"unlike no other† sounds pleasing to the ears of many speakers, but it is not standard English. Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Expressions category, check our popular posts, or choose a related post below:15 Terms for Those Who Tell the FutureBest Websites to Learn EnglishEach vs. Both

Effective Communication Skills Essay Example | Topics and Well Written Essays - 1500 words

Effective Communication Skills - Essay Example Effective communication skills are thus necessary to provide effective services in health care. Paul Leagans defines communication as the process by which two or more people exchange facts, ideas, impressions and feelings so that each person gains understanding of use, intent and meaning of the message (Schuster, 1999). Communication includes verbal as well as non-verbal exchange of information. It is necessary to practice effective communication skills in nursing so as to understand, empathize and support patients (Carrol and Dolly, 2008). This paper will elaborate on two elements of effective communication and the skills pertinent to these elements. It is crucial to develop effective communication skills so as to overcome the various barriers to communication. In nursing practice, barriers to communication include physiological, personal, cultural, psychological and physical barriers. Physiological barriers, for example, altered mental state may interfere with the patient’s ability to interpret information. The nurse’s attitude, knowledge and feeling towards a patient may also impede communication. Physical barriers include noise, distance and other environmental factors that may impede communication (Schuster, 1999). The elements of effective communication include the sender, message, channel of communication, receiver and feedback (Schuster, 1999). The sender (source) formulates programs and broadcasts the information, which they want to communicate. The effect of the message is dependent on the sender’s attitude, knowledge, social status and communication skills. The message is the information in physical form conveyed to the audience. The channel of communication is the media used by the source in facilitating communication to the receiver. The receiver decodes, translates the meaning and acts upon the information received. Feedback is the reaction to the information conveyed by the sender. This paper will focus on the message and the channel and the skills therein. There are various forms of message. They include words, signs, symbols and pictures. It comprises of message code, content and treatment (Schuster, 1999). Message code defines any form of signs and symbols that are structured in a meaningful format to the same people. This includes the use of language to convey information. Message content defines the material that is in the message. This is selected by the sender in putting across his information. On the other hand, message treatment shows the decisions which the source undertakes to select and arrange the codes and content. The message communicates the sender’s feelings, intentions and attitudes towards the audience (Balzer, 2007). In nursing practice, information is conveyed from one person to another within a short time. Effective communication skills are necessary to avoid errors in vital information, for example, treatment of a patient (Balzer, 2007). In effective communication, a messag e should elicit the desired action from the audience. It must be clear, timely, specific and in line with the intended objectives. This means that the nurse should ensure that the message is brief, accurate and meets the objectives of its purpose. In addition, the message should be conveyed in a language that the audience can understand. The use of complex vocabulary to explain the patient’s disease and treatment will interfere on the patient’s ability to understand as well as accept their condition. Nursing practice also involves gathering information about the patient, symptoms and their effects to the patient. The use of a common language will enhance understanding between the patient and the nurse (Christie and Robinson,

Art binder Essay Example | Topics and Well Written Essays - 2000 words

Art binder - Essay Example I will then paint Canada Newfoundland where I took two years of high school, Seattle, Los Angeles, Santa Monica, San Diego, and finally Pennsylvania. Therefore, I will have seven paintings each representing the above-mentioned places. I paint because of my passion to exploit and expose the beauty that is before us, but people rarely notice. In my work, I communicate the energy and exciting nature of my subjects by use of vibrant colors combined tactfully to create exemplary compositions. My desire to paint these places is brought by what I have felt, seen, and experienced while staying in the different towns. Additionally, I am interested in exploring human emotions, and thus, this is another area that I focus on in my artwork. My goal is to become a professional renowned artist and inspire other young people in my community who are interested in becoming artists. I am writing in response to the above referenced position. I would like to express my keen interest in joining your company in the position of Exhibition Assistant. It is my firm conviction that I will make a valuable contribution in steering the given task to fulfill the mandate of the company and lead it to levels of higher productivity and growth. Extensive learning about art and communication coupled with internship and volunteer involvement has given me a good background in handling and organizing exhibitions. In college, I majored in Art and Communication, which I have just finished awaiting graduation. Additionally, I have participated in voluntary program at the T.E.E.N and internship program at Karin Weber Gallery. These have helped me develop valuable skills especially communication and organizational skills on top of my creative thinking and decision-making ability. Additionally, I am well versed in computer programs and applications such as Adobe Photoshop and Filemaker Pro. Moreover, I have